Грунтовка применение: Как использовать грунтовку — применение грунтовки

Содержание

состав, расход, назначение и использование

Особенности грунтовки глубокого проникновения:

Принцип действия

Виды составов

Сравнение характеристик

Практическое применение

Пол, стены и другие поверхности во время ремонта нужно неоднократно грунтовать. Но не все укрепляющие средства действуют одинаково. Подробно разберемся, что представляет собой и для чего нужна грунтовка глубокого проникновения.

Средство предназначено для обеспыливания и укрепления оснований. В отличие от других грунтовочных смесей, ее частицы способны проникать в материал на глубину до 10 см. Они связывают рыхлую структуру и создают на поверхности слой, который повышает адгезию.

Рецептура разной продукции может существенно отличаться. Но ее основу составляют следующие компоненты:

  • Вода. Является разбавителем раствора. Ее доля составляет порядка 80%. Регулирует консистенцию смеси и количество активных компонентов на единицу объема.
  • Акрил. Смолы играют роль связующего вещества. Именно они укрепляют материал и создают на поверхности пленку с высокими показателями адгезии.
  • Полимеры. Придают жидкости повышенные характеристики капиллярного проницания. Они отвечают за способность частиц как можно глубже впитываться в основание.

Именно акриловые грунтовки глубокого проникновения стали самыми популярными и востребованными у мастеров.

Но кроме основных, есть и дополнительные компоненты. Они расширяют область применения грунта и придают ему новые свойства.

  • Антисептики. Противогрибковые компоненты. Их применяют если на поверхности присутствует плесень, грибок и другая бактериальная среда.
  • Силиконовые агенты. Отталкивают воду, придают основанию гидроизоляционные свойства.
  • Латекс. Повышает адгезионные показатели, применяется при повышенных требованиях к сцеплению слоев между собой.

Грунтовочные средства с добавками одновременно выполняют несколько функций, поэтому их называют универсальными.

В продаже встречаются составляющие, из которых своими руками можно приготовить средства для грунтования. Они будут стоить дешевле готовой заводской продукции. Но на хорошие результаты можно рассчитывать только, если полученная смесь соответствует ГОСТ.

Есть несколько классификаций грунтовочных средств. В зависимости от впитываемости поверхностей, на которые их наносят, выделяют:

  • Классический грунт. Подходит для обработки плотных слоев: бетон, штукатурка и т. д.
  • Праймер. Служит для предварительной обработки конструкций с рыхлой структурой.

Но большее значение для строителей имеет тип вяжущего, на основе которого изготовлены грунтовочные смеси. Рассмотрим их подробнее.

Акриловые

Являются универсальными, подходят для обработки подавляющего большинства оснований: бетонных, асбестоцементных, деревянных. Продукция имеет большие сроки хранения, а при загустевании может разбавляться водой, количество которой не должно превышать 10%. Важно лишь не просрочить рабочий состав.

Время высыхания составляет пару часов, что становится большим плюсом при сжатых сроках строительства. Состав не способен защитить металлические элементы от коррозии. Может применяться в качестве самостоятельного финишного покрытия после шпаклевания.

Алкидные

Способны взаимодействовать со всеми материалами, используемыми в строительстве.

При нанесении на металл, выполняют функцию преобразователей ржавчины. Создают защитную пленку, которая препятствует повторному появлению коррозии. Подходят для стали и чугуна.

Хорошо зарекомендовали себя для работы с железобетонными конструкциями в панельном домостроении. Повышают адгезию бетона и не дают проступать ржавчине на металлических закладных деталях.

В частном домостроении широко используются для обработки деревянных конструкций: балок перекрытия, элементов стропильных систем. В рецептуре присутствуют латексные частицы. Они скрепляют волокна даже во влажной среде, препятствуя их разбуханию.

Полиуретановые бетоноконтакты

Такие грунтовки глубокого проникновения для бетона используются при обработке невпитывающих поверхностей: окрашенных или монолитных стен. В рецептуру включают цемент и игольчатый кварц. Они делают материалы пригодными к нанесению последующих покрытий.

Продукция не получила широкого распространения. Жидкость сохнет около 12 часов, что замедляет работу. Ее использование оправдано лишь при отделке помещений полимерными смесями.

Силиконовые бетоноконтакты

Относятся к категории праймеров. Хорошо проникают в структуру материала, придают ему высокую прочность. Благодаря этому широко используются в наружной отделке. Применение таких грунтов внутри помещений ограничено из-за токсичности. Работать приходится в респираторах.

Плотность всех составов одинаковая — порядка тонны на кубометр. Поэтому в качестве растворителя используют воду.

Грунты выпускают в виде концентратов или готовой к применению продукции. Первые оказываются дешевле, их можно разводить до нужной консистенции в зависимости от типа обрабатываемой поверхности. Но для этого нужно иметь на объекте дополнительные емкости, в том числе мерные. Готовые составы удобны в использовании. В отличие от концентратов, важно следить за областью их применения. Жидкости, предназначенные для обработки под обои, не всегда подходят для первичного грунтования стен с высокой впитываемостью.

Время высыхания грунтовки глубокого проникновения и норма расхода на 1 м2 сильно зависят от рецептуры и типа обрабатываемых материалов. Впитываемость всегда нужно оценивать непосредственно на объекте. Поэтому рассмотрим, как сохнут разные типы грунтов при нанесении на бетон.

Тип грунта Назначение Время сушки, ч
Алкидный По дереву, металлу, бетону 10-14
Акриловый По бетону, штукатурке, древесине, кирпичу 2-4
Полиуретановый По всем впитывающим и невпитывающим основаниям 24
Силиконовый По бетону, кирпичу, штукатурке
4-5

Из представленной в рейтинге продукции, строители предпочитают использовать акриловые грунтовочные средства. Они имеют широкую область применения и быстро сохнут. Средний расход составляет порядка 50-100 грамм на 1 м2.

Все грунтовочные средства обладают схожим принципом действия. Выделим характерные особенности их применения перед проведением разных типов работ.

Оштукатуривание

При нанесении гипсовой штукатурки грунтуют стены из любых материалов. Так избавляются от пыли и укрепляют рыхлые структуры предшествующих покрытий.

Оштукатуривание с применением цементно-песчаных растворов не требует предварительной обработки. Напротив, грунтовочная смесь может полностью забить поры, что исключает попадание в них цементного молочка и снижает прочность. Даже при нанесении штукатурки на пористые газобетон или силикатный кирпич, достаточно просто смочить стены.

Шпаклевание

Перед применением шпаклевки всегда наносят грунтующее средство. Оно выполняет две функции:

  • Забивает поры. Все шпаклевки чувствительны к излишнему водопоглощению. При быстром обезвоживании смеси, добиться хорошей прочности не получится.
  • Обеспыливает стены. Жидкость для грунтования связывает пыль, которая образовалась во время проведения черновых работ.

Неважно сколько наносится слоев шпаклевки, грунтуют стены только перед первым. Если работать приходится в сырых помещениях, рекомендуют дополнительно использовать препараты из категории «антиплесень», а при контакте с древесиной и антигрибковые средства.

Заливка стяжки

В подавляющем большинстве случаев основанием служит железобетон. Он не нуждается в дополнительной обработке. Единственное, что необходимо сделать — обеспылить пол. Достаточно его тщательно пропылесосить и помыть. Когда нет желания отмывать поверхность, можно ее загрунтовать.

Если под ламинат или линолеум вы используете наливной пол, нужно руководствоваться рекомендациями производителя смеси.

Поклейка обоев

После шлифовки шпаклевки всегда остается много пыли. Самый простой способ избавиться от нее — загрунтовать стены. Обои — легкий материал, не требующий высокой прочности, поэтому можно воспользоваться грунтом эконом-класса.

Покраска

На излишне плотную, глянцевую после грунтования поверхность может не взяться краска. Поэтому всегда нужно исходить из конкретных условий и рекомендаций производителей. Если особых указаний нет, лучше воспользоваться концентратом. При этом добавить в него воды вдвое больше, чем указано в инструкции.

Во время ремонта всегда учитывайте особенности состава грунтовки глубокого проникновения, следуйте рекомендациям производителей и приведенным выше советам. Это позволит выполнить работы качественно и без переделок.

  • Материал подготовил: Игорь Степаньков

Для чего нужна грунтовка? Широкое применение и виды грунтовок

Грунтовочные составы – обязательно к применению

Грунтовкой называется специальный жидкий раствор, в котором подбор веществ обеспечивает требуемые эксплуатационные характеристики. Наличие клеевой составляющей служит для укрепления осыпающейся, рыхлой основы. Полимеры, цементирующие добавки и песок обеспечивают требуемую шершавость поверхности. Пленкообразующие компоненты (битум, смола, различные масла) нужны для образования на поверхности пленки в качестве защиты от воздействия внешней среды.

Дополнительно: к примеру, грунтовка по дереву так же является и антисептиком https://megabud.com.ua/products/grounding/gruntbio_D/, дерево ограждено от разрушительного воздействия грибка, гнили, грызунов и насекомых. Также, можно отдельно приобретать к грунтовке специальные наполнители, которые будут менять её конечные характеристики. Если вы планируете приобретать их, то обращайте внимание на продукцию той же фирмы, чьей грунтовкой пользуетесь.

Классификация грунтовочных составов, предложенных в ТМ «Мегабуд», в основном базируется в зависимости от места применения, по основе, на которую будет наноситься средство.

Виды строительных грунтовок – от черновой до чистовой отделки

Правильный выбор грунтовки и соблюдение правил применения в итоге сказывается на качестве внешнего результата – финишная отделка, будь – то обои, покраска или вскрытие дерева лаком радует глаз ярким глянцем, лоском, и сохраняют первоначальный внешний вид в течении минимум нескольких лет. Где и как используется грунтовка:

Минеральные поверхности

Стены и потолок строений: кирпич, бетон, шлакоблок и штукатурка – практически всегда нужен грунт глубокого проникновения с содержанием фунгицидных добавок. Предварительно поверхность очищается от посторонних включений, пылесосится, затем грунт наносят кистью или валиком. Как проверить итог – провести рукой по стене – если на ладони не остается следов, поверхность готова к дальнейшей обработке.

Деревянные поверхности

Грунтовка по дереву наносится поэтапно, сначала поверхность пропитывается антисептическим составом (можно наносить несколько слоев). Грунт на алкидной основе служит в качестве вспучивающего разрыхлителя основы, позволяя глубоко проникать краске, таким образом, покрытие держится значительно дольше. Шеллаковый грунт применяется для хвойной древесины с большим содержанием смол.

Металлические поверхности

Первичная обработка подразумевает полное удаление ржавчины, жирных и масляных пятен, для работы с металлом используются фосфатные, изолирующие грунтовки. Подбор зависит от факторов: черный/цветной металл, агрессивная/неагрессивная среда, какое покрытие будет наноситься далее.

Универсальная грунтовка – спектр достоинств

Использование грунтовки не только защищает от ряда проблем, досадно появляющихся уже после выполнения чистовой отделки – таких как проступание желтых пятен, отсыревание, отслаивание штукатурки и прочее. На покрытую грунтом поверхность значительно экономнее ложится краска, а значит – снижаем расход на финишную дорогостоящую отделку.

Сглаживание мелких дефектов, абсолютная защита от появлении плесени и грибка – грунтовки на акриловой основе применимы практически для любых материалов, используемых в строительстве. Отдельно следует отметить паропроницаемость, устойчивость к разрушительному воздействию окружающей среды, грунтовки достаточно быстро сохнут и прекрасно укрепляют основание. Обычно акриловые грунтовки высыхают за период от 4 до 6 часов, грунт на алкидной основе сохнет до 16 часов. Для применения достаточно простых подручных средств – емкости для раствора, кисти или валика, и защитных перчаток. После выполнения работ необходимо сразу очистить инструменты от вещества, достаточно промыть водой.

Как работать с грунтовкой?

Перед началом работ, необходимо зачистить рабочую поверхность. Чем тщательнее вы проведете эту процедуру, тем долговечнее будет держаться грунтовка. В первую очередь необходимо устранить старые остатки обоев, следы краски, грязь и пыль.

Идеальный инструмент для нанесения грунтовки – валик.

Если вы грунтуете открытый участок, то для работ можно использовать валик. Но самое главное – это обработать предварительно углы кистью. Причем грунтовку необходимо наносить максимально обильно.

Важно внимательно изучить надписи на упаковке, прежде чем начинать работу.

Дело в том, что грунтовка продается как в готовом виде, так и концентрированном. Во втором случае, её необходимо разбавить водой. Пропорции обычно указаны на упаковке.

Если пропорции не указаны, или вы хотите разбавить раствор из собственных соображений, то для этого есть универсальная формула: две порции грунтовки на одну порцию воды. При этом важно помнить о том, что смесь должна быть использована сразу.

Когда лучше всего разбавлять грунтовку?

Если речь идет о цементном или бетонном слое, то разбавлять грунтовку обязательно. Цемент и бетон активно впитывают жидкости, поэтому разбавленная грунтовка лучше всего проникнет в материал.

Как часто нужно грунтовать стену?

В первую очередь – перед нанесением штукатурки. Затем, перед покраской, шпаклевкой или поклейкой обоев. Таким образом, за время ремонта, вы дважды обработаете рабочие поверхности.

Расход грунтовки.

Обычно расходуется от 120 до 250 мл на квадратный метр. Чтобы было «с запасом» рекомендуем посчитать максимальную трату грунтовки, и добавить 10% от полученного объема.

И помните, тщательная подготовка обеспечивает 90% результата.

Подробнее о продукции ТМ «Мастер»

Мастер «Грунт»

Мастер «Ґрунт ― Біозахист»

Мастер «Грунт Контакт»

Грунтовка для стен: ее виды и предназначение

Содержание:
Универсальная грунтовка глубокого проникновения
Антигрибковая грунтовка для стен
Грунтовка бетоноконтакт: назначение и сфера применения

Можно ли представить современный ремонт без использования грунтовок? Строители на этот вопрос ответят отрицательно. Прямое назначение грунтовок – это изменение свойств поверхностей в лучшую сторону. С их помощью можно увеличить адгезию практически любого материала, лишить возможности впитывать влагу и изменить его структуру, сделав невозможным развитие болезнетворных микроорганизмов. Именно эти свойства грунтовок и обуславливают их широкое применение. Скажем так, профессиональные строители и ремонтники грунтуют все и всегда – если вы хотите получить качественный и долговечный результат, то этого процесса не избежать. Именно о таких составах мы и поговорим в этой статье, в которой вместе с сайтом stroisovety.org разберем вопрос, что такое грунтовка для стен, ознакомимся с ее разновидностями и научимся правильно пользоваться этим строительным материалом.

Грунтовка для стен фото

На сегодняшний день в строительстве и ремонте применяется три основных типа грунтовок – антигрибковая, грунтовка глубокого проникновения (универсальная) и грунтовка бетоноконтакт. Их мы и рассмотрим в данной статье.

Универсальная грунтовка глубокого проникновения

Этот вид грунтовки имеет одно предназначение – в его задачи входит убивать пыль и скреплять верхний слой поверхности, тем самым увеличивая способность материалов приставать друг к другу. Чтобы полностью понять смысл этого вида грунтовки, необходимо попробовать приклеить что-либо на поверхность тех же стен без грунтовки и с ней, а потом попробовать оторвать приклеенный предмет. На прогрунтованной поверхности это будет сделать практически невозможно, а вот с негрунтованной поверхности оторвать приклеенный предмет достаточно просто. Штукатурка, шпаклевка, кафельная плитка или что-либо другое, нанесенное на негрунтованные стены, уже через год начинает бухтеть и отваливаться.

Что же представляет собой грунтовка глубокого проникновения? По сути, это водный раствор, изготовленный на основе алкидных или эпоксидных смол. После ее высыхания верхний слой стены, пола или потолка глубиной до 2–3мм склеивается изнутри, а на поверхности образуется тонкая пленка, обеспечивающая надежное сцепление со строительными материалами.

Грунтовка универсальная для стен

Грунтовка для бетона в неумелых руках пользы способна принести мало – дело в том, что ею еще нужно уметь правильно пользоваться. На каждую поверхность она наносится по-разному – к примеру, на ошкуренную шпаклевку раствор можно нанести валиком или даже с ручного пульверизатора.

В принципе, сама по себе шпаклевка имеет довольно пористую структуру и легко впитывает жидкие материалы. Совсем другое дело бетон или цементный раствор – он крупнозернистый и для надежного скрепления поверхностного слоя грунтовке необходимо помочь проникнуть в их структуру. Чтобы надежно скрепить бетонные и цементные поверхности, а заодно и очистить их от осыпающихся песчинок, грунт необходимо втирать макловицей до образования белой пены. Только так можно обеспечить надежную адгезию бетонных и цементно-песчаных поверхностей.

Теперь о применении универсальной грунтовки. Исходя из ее названия, можно сделать вывод, что она применяется везде. А так оно и есть. Она пригодна как для наружных, так и для внутренних работ – если речь идет о грунтовке под обои, под покраску или под наружную штукатурку, то именно эта грунтовка имеется в виду. Ярким представителем такого строительного материала является грунтовка Ceresit CT 17.

Универсальная грунтовка Ceresit CT 17 фото

Антигрибковая грунтовка для стен

Этот вид грунтовочных смесей применяется для борьбы с грибковыми образованиями и плесенью. Следует понимать одну разницу – существуют профилактические антигрибковые грунтовки и агрессивные составы, предназначенные именно для борьбы с уже обосновавшимся грибком или плесенью. Обычная антигрибковая грунтовка является мерой профилактики, и она способствует тому, чтобы грибок не появился – в большей степени такую грунтовку можно отнести к разряду универсальных, так как они выполняют двоякую функцию. Одновременно они скрепляют поверхность, увеличивают адгезию материалов и предотвращают появление грибковых образований.

Грунтовка для внутренних работ фото

Если речь идет о настоящей антигрибковой грунтовке, которая в состоянии справиться с засильем этих паразитов, то следует обратить свое внимание на составы, подобные Ceresit CT 99 – они не только эффективно предотвращают появление грибка или плесени, но и успешно убивают целые плантации этих паразитов. Такой вид состава является грунтовкой для внутренних работ и снаружи помещения не применяется.

Антигрибковая грунтовка: особенности применения

Грунтовка бетоноконтакт: назначение и сфера применения

В принципе, с появлением этого вида грунтовки возникла возможность соединять, как говорится, несоединимое. К примеру, на глянцевую поверхность стекла стало возможным приклеить кафельную плитку с помощью обыкновенно клея, типа Ceresit CM 11. С таким же успехом, используя грунтовку бетоноконтакт, можно смело шпаклевать окрашенные масляной краской или нитроэмалью стены и не бояться того, что шпаклевка со временем отстанет.

Весь секрет этой грунтовки заключается в ее составе – по сути, это сильный клей с наполнителем в виде мелкого кварцевого песка, который создает шершавую поверхность и тем самым позволяет приклеить к ней что угодно и чем угодно.

Бетоноконтакт грунтовка фото

К этому классу грунтовок можно отнести и так называемые краски грунтовки типа Ceresit CT 16 – в их состав также входит кварцевый песок, но в отличие от бетоноконтакта, они немного слабее. Если с помощью бетоноконтакта можно соединить полностью глянцевые поверхности, то вот с помощью краски-грунтовки этого сделать нельзя. Вернее возможно, но немного не в таких обстоятельствах. Бетоноконтакт способен выдерживать большую нагрузку, и его применяют для укладки кафеля и при штукатурных работах – в отличие от него, краска-грунтовка предназначена для работы с более легкими строительными материалами.

Грунтовка под обои фото

Кстати, краска-грунтовка является отличным консервантом для наружных поверхностей. Если по какой-либо причине отделка стен остановилась на стадии штукатурки, то чтобы предотвратить ее разрушение в зимний период, поверхность достаточно вскрыть краской-грунтовкой. Обычная грунтовка глубокого проникновения такими возможностями не обладает.

В общем, современная грунтовка для стен является отнюдь не лишним элементом строительства или ремонта. Спросите любого мастера о ее назначении и применении, и вам ответят, что без нее не обойтись. По сути, поверхности стен, потолка или пола грунтуют практически после каждой операции. Прогрунтовали – ошпаклевали, прогрунтовали – поклеили обои. Такой подход к делу характерен для всех видов отделочных работ без исключения.

Автор статьи Александр Куликов

Что такое акриловая грунтовка глубокого проникновения?

Акриловая грунтовка повышает адгезию слоев разных строительных материалов. Ее использование улучшает сцепление между штукатуркой и краской, обоями или плиточным клеем. Кроме этого, этот строительный материал укрепляет старые штукатурные слоя, снижает впитываемость поверхностей. Применение грунтовки позволяет уменьшить расход основных строительных материалов.

Некоторые люди считают, что сделать ремонт можно и без грунтовки, чтобы сэкономить. В большинстве случаев такая экономия приводит к большим расходам шпатлевки, краски, обойного или плиточного клея, что влечет за собой финансовые растраты. Помимо того, что акриловая грунтовка значительно повышает качество отделочных работ, она защищает поверхности от воздействия воды и разного рода повреждений, а также уничтожает плесень и грибки.

Основными составляющими являются латексные смеси и акриловая основа. После нанесения и высыхания на поверхности образуется прочная пленка, напоминающая слой акрилового лака. Для нанесения грунта используют кисточку, валик или пульверизатор.

Типы акриловых грунтовок

Грунтовка имеет несколько видов классификаций. Во-первых, нужно знать, что грунтовки могут быть органорастворимые и водорастворимые. Первые используются для фасадов, а также наружных поверхностей. Они имеют высокую устойчивость к атмосферным осадкам. Поверхности, обработанные такой грунтовкой, обладают противогрязевыми свойствами и не поддаются разрушения паразитами и грызунами.

Водорастворимые предназначены для улучшения отделочных работ внутри помещений, а также обработки любых внутренних поверхностей.

Во-вторых, в зависимости от состава грунтовка может быть:

  • универсальная;
  • глубокого проникновения;
  • адгезионная;
  • специальная;
  • укрепляющая.

Наиболее широкое применение нашла укрепляющая и поникающая грунтовка. Главное их отличие заключается в размерах частиц связующего вещества. Поскольку акриловая грунтовка глубокого проникновения имеет более мелкие частицы, она проникает на глубину до 10 см. Отлично укрепляет любую поверхность. Укрепляющая грунтовка из-за более крупных частиц на обработанной поверхности оставляет после высыхания прочную пленку.

Где применяется акриловая грунтовка?

Этот стройматериал можно назвать универсальным, поскольку подходит для обработки разных поверхностей. Акриловой грунтовкой обрабатываются оштукатуренные стены, кирпичная кладка, гипсокартон, бетонные поверхности и шлакоблок. Но применение акриловой грунтовки этим не заканчивается. Нередко ее используются для обработки дерева и материалов, производственных от дерева.

В зависимости от типа грунтовки она может использоваться для разных поверхностей и разных целей. Укрепляющая грунтовка применяется для оштукатуренных и шпатлеванных поверхностей перед покраской или оклеиванием обоями. Больше всего подходит для рыхлых поверхностей.

Глубоко проникающая грунтовка пропитывает поверхность на глубину до 10 см, поэтому эффективно используется для потолков, укрепления старой штукатурки, кирпичных и бетонных стен.

Если необходимо устранить вероятность возникновения плесени или грибка, применяется специальная или антисептическая грунтовка. Также в инструкции производитель всегда указывает, для каких поверхностей предназначен грунт. Обязательно нужно соблюдать этот пункт инструкции, как и остальные.

Технические характеристики

На технические характеристики акриловой грунтовки влияет ее состав, соотношение основных компонентов, а также размер частиц. В зависимости от этого меняются характеристики и применение, но общие свойства остаются неизменными:

  • улучшение адгезии;
  • антисептичность;
  • водостойкость;
  • устойчивость к механическим и химическим повреждениям;
  • укрепление поверхности;
  • экономия отделочных материалов;
  • сохранение паропроницаемости.

Форма выпуска акриловой грунтовки

Выпускается в трех видах:

  1. Сухие смеси. Встречаются очень редко.
  2. Паста. Реализуется в пластмассовых ведерках разного объема. Разводиться водой перед нанесением или наносится при помощи шпателя тонким ровным слоем.
  3. Жидкость. Продается в канистрах от 2 до 10 л. Наиболее распространенный вид. Прост в использовании, не требует разбавления.

Хранение

Хранение акриловой грунтовки зависит от вида и формы выпуска. Длительный срок годности имеют сухие смеси, но их не всегда удается найти в продаже. Пастообразная грунтовка может храниться около 6 месяцев, но при условии, что она запечатанная. Если ее открыли, то желательно использовать, так как она может утратить свои свойства.

Закрытый жидкий грунт храниться 1,5 года. После открытия используется на протяжении нескольких недель, но только, если после каждого применения плотно закрывается крышкой. Хранить акриловую грунтовку нужно при комнатной температуре, избегая прямых солнечных лучей.

Меры безопасности

Поскольку водорастворимые грунтовки считаются безопасными, то их применение не требует особых мер предосторожности. Но надеть рукавички, защитить глаза и дыхательные пути не помешает. После окончания работ нужно хорошо проветрить помещение.

А вот органорастворимые относятся к токсичным материалам. Поэтому во время работы необходимо соблюдать строгие меры безопасности, в том числе обязательно использовать резиновые рукавички и респиратор.

Производители

Наибольшим спросом на рынке пользуются грунтовки таких производителей, как «Knauf» и «Ceresit». Многие потребители отдают предпочтение «Моменту» и другим отечественным производителям. Сегодня многие компании СНГ изготавливают грунтовку при использовании импортных технологий, поэтому ее качество на высоком уровне.

Применение акрилового грунта значительно упрощает процесс отделочных работ и снижает расход строительных материалов. Главное, соблюдать инструкцию, написанную производителем.

Узнать, как изготавливается искусственный камень, можно в этой статье.

Зачем нужна грунтовка: виды, применение, назначение.

Грунтовка представляет собой специальный состав, который наносится первоочередным слоем на предварительно подготовленные к отделке или окраске поверхности (бетон, металл, кирпич, дерево, штукатурка и др.).

Грунтовки применяют  как  для внутренних, так и для наружных  работ.

При нанесении грунтовки на рабочую поверхность  основной ее задачей остается обеспечение прочного сцепления любого последующего слоя, что дает гарантию ровного финишного покрытия.  

В зависимости от состава и компонентов грунтовка может быть:

  • Акриловая.   Применяется на различных поверхностях, от бетона до дерева, в соответствии с маркировкой от производителя. Также есть универсальная акриловая грунтовка.
  • Алкидная.  В состав данной категории  входят поливинилхлориды, полиуретан, полистирол, ацетатные компоненты и красители. По своей природе такие грунтовки фактически универсальны.
  • Эпоксидная. В основе состава смола и добавки химического происхождения. Поверхность после обработки приобретает плотную матовую или глянцевую плёнку, максимально устойчивую к агрессивным воздействиям окружающей среды
В зависимости от свойств, которыми обладает грунтовка, их можно разделить на следующие категории:
  • Универсальная. Используется для поверхностей, которые сочетают в себе несколько характеристик.
  • Антикоррозионная. Используется на металлической поверхности для защиты от ржавчины.
  • Антисептическая. Незаменима при работе с деревянными основаниями и при обработке старых построек.
  • Водоотталкивающая. Образовывает защитный слой во влажных помещениях.
  • Финальная. Завершает цикл черновых отделочных работ, предшествует декоративной отделке.

 

Таким образом, применение грунтовки обеспечивает вам:

  • Надежное сцепление покрывающих слоев
  • Увеличение  срока службы отделочных материалов.
  • Защиту металлов от коррозийных изменений
  • Коррекцию впитывающей способности
  • «Заполнение» пор и других мелких дефектов поверхности перед покраской
  • «Выявление» текстурированного рисунка дерева и др.
  • Антисептическое действие.
  • Защиту от влаги.

В ассортименте нашей компании представлены грунтовки разных назначений для всех отраслей промышленности. По вопросам подбора ЛКМ обращайтесь по телефону 8-800-500-52-11 или пишите на почту [email protected]

Грунтовка по бетону — виды грунтовок, применение и расход

Поверхность бетонных изделий, домов, сооружений и других конструкций в силу своей пористой структуры «поражается» атмосферными осадками. Дождевая или талая вода проникает в поры поверхности. При минусовой температуре замерзает и согласно закону физики расширяется в объеме и в буквальном смысле слова «рвут» поверхность на мелкие кусочки.

СодержаниеСвернуть

С каждым годом пораженные участки увеличиваются в размерах. Грунтовка по бетону успешно решает вопрос эффективной защиты поверхности бетона на многие годы. Кроме того, материал соответствующего типа используется для улучшения адгезии отделочных материалов к бетонной основе и других целей.

Классификация грунтовок по бетону

Производители и торговые сети, в зависимости от конечной цели, предлагают обработать бетон различными видами грунтовочных составами, которые классифицируются по 5 основным факторам. Для наглядности и простоты понимая, составим таблицу классификации:

Фактор классификацииВид грунтовки
Основа составаакриловая грунтовка для бетона, минеральная, фосфатная, полистирольная, глифталевая, кварцевая, алкидная и эпоксидная грунтовка по бетону.
Степень проникновения в толщу поверхностиСтандартная и глубокая грунтовка бетона.
НазначениеУниверсальная, для штукатурки, монтажа отделочных материалов.
Тип основыДля наружных работ, для внутренних работ, универсальная.
Решаемая задачаВлагозащитная, противогрибковая, антикоррозийная, противопожарная, антисептическая.

Характеристики популярных грунтовок по бетону

  • Полистирольная грунтовка. В силу наличия в составе высокотоксичных компонентов, полистирольный грунт применяется как защитная грунтовка наружная для бетона. Также полистирольный грунт применяют как материал для улучшения адгезии кафельной плитки, керамогранита и краски к оштукатуренной поверхности в зданиях производственного назначения. Популярные марки: «Грунт ПУ-2К», «Элакор-ПУ», «ПУ-555».
Полистирольная грунтовка по бетону
  • Акриловая грунтовка для внутренних работ. Самый распространенный универсальный вид, допускающий применение в помещениях любого назначения, в том числе в спальнях и детских комнатах. Материал характеризуется отсутствием резкого запаха, хорошей проникающей способностью, совместимостью со всеми видами отделочных материалов и коротким периодом высыхания не более 3-4 часов после нанесения. Не применяется для наружных работ. Популярные марки: «Аквопол-грунт», «Проакрил-грунт», «Грунт фасадный «Акриал».
Акриловая грунтовка для внутренних работ
  • Полиуретановая грунтовка для бетона. Относится к защитным материалам. После нанесения на поверхность выполняет функцию гидроизоляции от капиллярной влаги и защищает от остаточной влажности в стяжке пола. Допускается эксплуатация внутри помещений и в формате «под навесом» снаружи зданий. Перед нанесением краски или побелки, поверхность, обработанная полиуретановым материалом, должна быть тщательно высушена. Популярные марки: «Полибетол-грунт», «ПС-грунт», «Элакор-ПУ Грунт».
Полиуретановая грунтовка для бетона
  • Грунтовка глубокого проникновения для бетона. Представляет собой водорастворимые составы на основе латексных смесей и акриловой краски с добавлением небольшого количества твердых частиц. Грунтовки этого вида имеют высокий уровень проникновения в толщу основы (на глубину от 5 до 10 мм), и соответственно обеспечивают долговременную защиту от влаги, плесневого грибка и прочих вредных природных факторов. В связи с этим это самая универсальная грунтовка антисептик для бетона, увеличивающая прочность и водоотталкивающую способность поверхности. Популярные марки: «Marshall фасадный грунт», «Dulux Bindo Base», «Ceresit СТ 17 Супер».
Грунтовка глубокого проникновения для бетона
  • Грунтовка Бетон Контакт. Это специальный состав, обеспечивающий надежное сцепление отделочных материалов с идеально гладкой бетонной поверхностью. Для этого в состав грунтовок этого вида добавляют кварцевый песок (фракцией частиц от 0,3 до 0,6 мм) или мраморную крошку, как в материале грунтовка водно дисперсионная Бирсс Контакт, значительно повышающие сцепляемость отделочных материалов с бетонной поверхностью. Популярные марки: «БетонContact», «Neomid Бетон-контакт», «Aquaprime-023».
Грунтовка Бетон Контакт
  • Поливинилацетатные составы. Сохнут в течение 30 минут и применяются для очень быстрой отделки помещений. Популярные марки: «Грунтовка Bostik 6000», «Sader Unidur 10», «Грунтовка «Старт».
Поливинилацетатные грунтовки
  • Эпоксидная грунтовка. Соответственно названию готовится на основе эпоксидной смолы, отличающейся высокой механической прочностью и высокой стойкостью к истиранию. Основная область применения – обработка наливных полов для увеличения износостойкости и под покраску. Популярные марки: «Топпинг-Грунт», «Эполаст-грунт», «Sikafloor-156 (A)».
Эпоксидные грунтовки
  • Грунты на алкидной основе. Обычно наносят на бетонный пол под окраску. Алкидная грунтовка обладает хорошей проникающей способностью и надежно защищает поверхность конструкции от влаги. Популярные марки: «Грунтовка акриловая универсальная «ЯРОСЛАВСКИЙ КОЛОРИТ», «Грунтовка акриловая универсальная антикоррозионная ГФ-021 «ЯРОСЛАВСКИЙ КОЛОРИТ», «Грунтовка акриловая глубокого проникновения «НОРМА».
Грунты на алкидной основе

Расход грунтовки

Подводя черту, стоит осветить важный потребительский фактор – это необходимый расход грунтовки на бетон. Расход материала на единицу поверхности указывается на упаковке грунта.

Поэтому приведенные ниже цифры являются справочными для ориентировки покупателя до покупки того или иного вида товара: Бетон-контакт  от 200 до 400 г/м2, грунт глубокого проникновения от 80 до 160 г/м2, универсальные грунтовки от 50 до 120 г/м2, алкидные грунты от 70 до 130 г/м2, акриловые от 120 до 150 г/м2.

Грунтовки — Акриловая Грунтовка — Блокатор Seal Grip, латексная грунтовка, Акриловый грунт для наружных и внутренних работ Perma-Crete, Фасадная Грунтовка, Влагостойкая грунтовка быстрого высыхания, грунтовка глубокого проникновения

Грунтовка
Грунтовка поверхности на большинстве этапов строительства и ремонта не просто рекомендуется,  а даже входит в перечень основных процедур, которые утверждены государственными строительными нормами. В каждом конкретном случае грунтовка для стен и пола необходима с особенными физико-техническими свойствами. Это связано с тем, что грунтовка способна в несколько раз улучшить качество отделочных и строительных работ. Мы предлагаем широкий ассортимент грунтовок для шпаклевки, штукатурки, дерева, пластика, металла, бетона и прочих поверхностей, которые служат для увеличения адгезии и защиты, а так же для придания обрабатываемой поверхности антисептических и фунгицидных свойств и её укрепления. Чаще всего наши клиенты решают,какую лучше купить грунтовку – глубинную или укрывную.

Как выбрать грунтовку:
Как известно, грунтовки могут быть как жидкие прозрачные, так и густые белого цвета. Такие грунтовки отличаются в первую очередь ценой.


Жидкие грунтовки глубокого проникновения – это недорогие грунтовки, основной целью которых является укрепление верхнего слоя поверхности и связывание пыли. Некоторые жидкие грунтовки имеют в своем составе гасящие щелочи компоненты.  

Плюсы жидких грунтовок:
а) небольшая цена
б) на 25% глубже проникают в поверхность по сравнению с густыми грунтовками.

Минусы жидких грунтовок:
а) прозрачность
б) после нанесения грунтовки такого типа возможно образование неоднородной глянцевитости в местах, где глубинная грунтовка нанесена в два слоя (это случается очень часто, так как нанести равномерно, без нахлестов глубинный грунт очень сложно). В результате неоднородная глянцевитость будет видна и после нанесения краски.
в) не препятствую проникновению пятен из поверхности.  

Густые белые грунтовки – это грунтовки другой ценовой и качественной категории (в сравнении с глубинными грунтовками), основной целью которых является укрепление верхнего слоя поверхности, связывание пыли и создания безупречной поверхности для дальнейшей покраски. Некоторые густые грунтовки имеют в своем составе щелочи гасящие компоненты и специальные добавки против плесени и грибка.

Плюсы густых белых грунтовок:
а) формируют белую подложку
б) хорошо заполняют микропоры
в) выравнивают неоднородную пористость поверхности
г) препятствую проникновению пятен из поверхности  

Минусы густых грунтовок:
а) на 25% ниже проникающая способность по сравнению с глубинными грунтовками.  Можем сделать выводы: грунтовку глубокого проникновения предпочтительней применять на пористые поверхности или с целью экономии. Густые белые грунтовки можно применять на любых поверхностях.

В случаях, когда требуется достижение максимально качественного результата покраски на очень пористой или проблемной поверхности, возможно применение двух грунтовок – на первый слой глубинную грунтовку, а на второй слой густую белую грунтовку. Например, оштукатуренный фасад, цокольная часть зданий или здания с отсутствующей гидроизоляцией фундамента (построенные более 50 лет назад, архитектурные памятники, заборы).

Наша компания готова предложить целый ряд высококачественных грунтовок, при помощи которых будут решена масса ранее возникавших проблем с покраской:  

1) Прозрачная грунтовка глубокого проникновения стойкая к щелочам Speed hide 6-808

2) Белая грунтовка глубокого проникновения особо стойкая к щелочам и мигрирующим по поверхности солям Perma-Crete 4-809

3) Густые белые грунтовки, блокирующие пятна, щелочи, сажу, танины и капиллярную влагу Perma-Crete 4-603, Seal Grip 17-921.

4) Густые белые грунтовки для внутренних работ Speed hide 6-4, Speed hide 6-2

BatchPrimer3: высокопроизводительное веб-приложение для разработки праймеров для ПЦР и секвенирования | BMC Bioinformatics

  • 1.

    Abd-Elsalam KA: Инструменты биоинформатики и руководство по разработке праймеров для ПЦР. Африканский журнал биотехнологии 2003, 2 (5): 91–95.

    CAS Статья Google Scholar

  • 2.

    Ян X, Шеффлер Б. Е., Вестон Л. А.: Последние разработки в области дизайна праймеров для полиморфизма ДНК и профилирования мРНК у высших растений. Заводские методы 2006, 2 (1): 4. 10.1186 / 1746-4811-2-4

    PubMed Central Статья PubMed Google Scholar

  • 3.

    Розен С., Скалецкий Х.Ю.: Primer3 в WWW для обычных пользователей и программистов-биологов. В Биоинформатические методы и протоколы: методы в молекулярной биологии . Под редакцией: Кравец С., Мизенер С. Тотова, Нью-Джерси, Humana Press; 2000: 365–386.

    Google Scholar

  • 4.

    Koressaar T, Remm M: Улучшения и модификации программы создания праймеров Primer3. Биоинформатика 2007, 23 (10): 1289–1291. 10.1093 / биоинформатика / btm091

    CAS Статья PubMed Google Scholar

  • 5.

    Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA: Primer3Plus, усовершенствованный веб-интерфейс для Primer3. Nucleic Acids Res 2007, 35 (выпуск веб-сервера): W71–4. 10.1093 / nar / gkm306

    PubMed Central Статья PubMed Google Scholar

  • 6.

    Джуэлл Э., Робинсон А., Сэвидж Д., Эрвин Т., Лав К.Г., Лим Г.А., Ли X, Бэтли Дж., Спангенберг Г.С., Эдвардс Д.: SSRPrimer и SSR Дерево таксономии: открытие биома SSR. Nucleic Acids Res 2006, 34 (выпуск веб-сервера): W656–9. 10.1093 / nar / gkl083

    PubMed Central CAS Статья PubMed Google Scholar

  • 7.

    Hu ZL, Glenn K, Ramos AM, Otieno CJ, Reecy JM, Rothschild MF: Expeditor: конвейер для разработки праймеров с использованием структуры генов человека и информации EST домашнего скота. J Hered 2005, 96 (1): 80–82. 10.1093 / jhered / esi015

    CAS Статья PubMed Google Scholar

  • 8.

    Weckx S, De Rijk P, Van Broeckhoven C, Del-Favero J: SNPbox: модульный пакет программного обеспечения для крупномасштабного проектирования грунтовки. Биоинформатика 2005, 21 (3): 385–387. 10.1093 / биоинформатика / bti006

    CAS Статья PubMed Google Scholar

  • 9.

    ван Барен MJ, Heutink P: Пакет PCR. Биоинформатика 2004, 20 (4): 591–593. 10.1093 / биоинформатика / btg473

    CAS Статья PubMed Google Scholar

  • 10.

    Raddatz G, Dehio M, Meyer TF, Dehio C: PrimeArray: дизайн праймера в масштабе генома для конструирования ДНК-микрочипов. Биоинформатика 2001, 17 (1): 98–99. 10.1093 / биоинформатика / 17.1.98

    CAS Статья PubMed Google Scholar

  • 11.

    Варшней Р.К., Гранер А., Сорреллс М.Э .: Генические микросателлитные маркеры в растениях: особенности и применения. Trends Biotechnol 2005, 23 (1): 48–55. 10.1016 / j.tibtech.2004.11.005

    CAS Статья PubMed Google Scholar

  • 12.

    Пауэлл В., Марчрей Г.С., Прован Дж .: Полиморфизм, переоцененный простыми повторами последовательности. Trends Plant Sci 1996, 1: 215–222.

    Артикул Google Scholar

  • 13.

    Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, McCouch S: Вычислительный и экспериментальный анализ микросателлитов риса (Oryza sativa L.): частота, вариация длины, ассоциации транспозонов и потенциал генетических маркеров. Genome Res 2001, 11 (8): 1441–1452. 10.1101 / gr.184001

    PubMed Central CAS Статья PubMed Google Scholar

  • 14.

    Дворжак Дж., Ахунов Э.Д., Ахунова А.Р., Андерсон О.Д., Андерсон Дж. А., Блейк Н., Клегг М.Т., Коулман-Дерр Д., Конли Э.Дж., Кроссман С.К., Дил К.Р., Дубковски Дж., Гилл Б.С., Гу YQ, Hadam J, Heo HY, Huo N, Lazo GR, Lundy KE, Luo MC, Ma YQ, Matthews DE, McGuire PE, Morrell P, Qualset CO, Renfro J, Reynolds S, Dindo T, Talbert LE, Tian C, Toleno D , Warburton M, You FM, Zhang W: SNP-маркеры пшеницы: разработка, отображение и внедрение.В геномах растений и животных XIV . Сан-Диего, США; 2007.

    Google Scholar

  • 15.

    Собрино Б., Брион М., Карраседо А: SNP в судебной генетике: обзор методологий типирования SNP. Forensic Sci Int. 2005, 154: 181–194. 10.1016 / j.forsciint.2004.10.020

    CAS Статья PubMed Google Scholar

  • 16.

    Ye S, Dhillon S, Ke X, Collins AR, Day IN: эффективная процедура генотипирования однонуклеотидных полиморфизмов. Nucleic Acids Res 2001, 29 (17): E88–8. 10.1093 / nar / 29.17.e88

    PubMed Central CAS Статья PubMed Google Scholar

  • 17.

    Dieffenbatch CW, Lowe TMJ, Dveksler GS: Общие концепции конструирования праймеров для ПЦР. В праймере для ПЦР , Лабораторное руководство . Под редакцией: Dieffenbatch CW, Dveksler GS. Нью-Йорк, издательство лаборатории Колд-Спринг-Харбор; 1995: 133–155.

    Google Scholar

  • 18.

    Бреслауэр К.Дж., Франк Р., Блокер Х., Марки Л.А.: Прогнозирование стабильности дуплекса ДНК на основе последовательности оснований. Proc Natl Acad Sci USA 1986, 83 (11): 3746–3750. 10.1073 / pnas.83.11.3746

    PubMed Central CAS Статья PubMed Google Scholar

  • 19.

    Санта-Люсия-младший: единый взгляд на термодинамику ближайших соседей полимерной, гантелевой и олигонуклеотидной ДНК. Proc Natl Acad Sci USA 1998, 95 (4): 1460–1465.10.1073 / pnas.95.4.1460

    PubMed Central CAS Статья PubMed Google Scholar

  • 20.

    Поиск SSR [ftp://gramene.org/pub/gramene/software/scripts/ssr.pl]

  • 21.

    Chen X, Levine L, Kwok PY: Поляризация флуоресценции в гомогенной нуклеиновой кислоте анализ. Genome Res 1999, 9 (5): 492–498.

    PubMed Central CAS PubMed Google Scholar

  • 22.

    Hsu TM, Chen X, Duan S, Miller RD, Kwok PY: Универсальный анализ генотипирования SNP с детектированием поляризации флуоресценции. Biotechniques 2001, 31 (3): 560, 562, 564–8, passim.

    Google Scholar

  • 23.

    Угоццоли Л. Уолланс, РБ: Аллель-специфическая полимеразная цепная реакция. Methods Enzymol 1991, 2: 42–48. 10.1016 / S1046-2023 (05) 80124-0

    CAS Статья Google Scholar

  • 24.

    Ньютон С. Р., Грэм А., Хептинстолл Л. Е., Пауэлл С. Дж., Саммерс К., Калшекер Н., Смит Дж. К., Маркхэм А. Ф.: Анализ любой точечной мутации в ДНК. Система устойчивых к амплификации мутаций (ARMS). Nucleic Acids Res 1989, 17 (7): 2503-2516. 10.1093 / nar / 17.7.2503

    PubMed Central CAS Статья PubMed Google Scholar

  • 25.

    Drenkard E, Richter BG, Rozen S, Stutius LM, Angell NA, Mindrinos M, Cho RJ, Oefner PJ, Davis RW, Ausubel FM: простая процедура анализа однонуклеотидных полиморфизмов облегчает отображение на карте клонирование в Arabidopsis. Plant Physiol 2000, 124 (4): 1483–1492. 10.1104 / pp.124.4.1483

    PubMed Central CAS Статья PubMed Google Scholar

  • 26.

    Чжан В., Джанибелли М.С., Ма В., Рэмплинг Л., Гейл К.Р.: Идентификация SNP и разработка аллель-специфичных маркеров ПЦР для аллелей гамма-глиадина в Triticum aestivum. Theor Appl Genet 2003, 107 (1): 130–138.

    CAS PubMed Google Scholar

  • 27.

    Bundock PC, Cross MJ, Shapter FM, Henry RJ: Надежные аллель-специфичные маркеры полимеразной цепной реакции, разработанные для однонуклеотидных полиморфизмов в экспрессируемых последовательностях ячменя. Theor Appl Genet 2006, 112 (2): 358–365. 10.1007 / s00122-005-0137-6

    CAS Статья PubMed Google Scholar

  • 28.

    Хаяси К., Йошида Х., Асикава И.: Разработка наборов аллель-специфичных маркеров и маркеров InDel на основе ПЦР для девяти генов устойчивости к засорению риса. Theor Appl Genet 2006, 113 (2): 251–260. 10.1007 / s00122-006-0290-6

    CAS Статья PubMed Google Scholar

  • 29.

    Little S: ARMS анализ точечных мутаций. В Лабораторные методы обнаружения мутаций и полиморфизмов в ДНК . Отредактировано: Тейлор, Дж. Р. Бока Ратон, Флорида, CRC Press; 1997: 45–51.

    Google Scholar

  • 30.

    Ruiz-Sanz JI, Aurrekoetxea I, Ruiz del Agua A, Ruiz-Larrea MB: Выявление полиморфизма катехол-O-метилтрансферазы Val158Met с помощью простой одностадийной тетра-праймерной системы устойчивых мутаций — ПЦР. Mol Cell Probes 2007, 21 (3): 202–207. 10.1016 / j.mcp.2006.12.001

    CAS Статья PubMed Google Scholar

  • 31.

    Лейва-Бака I, Шенкель Ф., Шарма Б.С., Янсен Г.Б., Карроу Н.А.: Идентификация однонуклеотидных полиморфизмов в генах CCL2, IL8, CCR2 и IL8RA крупного рогатого скота и их связь со здоровьем и продуктивностью канадских голштинов. Anim Genet 2007, 38 (3): 198–202. 10.1111 / j.1365-2052.2007.01588.x

    CAS Статья PubMed Google Scholar

  • 32.

    Chiapparino E, Lee D, Donini P: Генотипирование однонуклеотидных полиморфизмов в ячмене с помощью тетра-праймеров ARMS-PCR. Геном 2004, 47 (2): 414–420.

    CAS Статья PubMed Google Scholar

  • 33.

    Okayama N, Fujimura K, Nakamura J, Suehiro Y, Hamanaka Y, Hinoda Y: Оценка новой эффективной процедуры генотипирования однонуклеотидного полиморфизма: тетра-праймерная система устойчивых мутаций — полимеразная цепная реакция. Clin Chem Lab Med 2004, 42 (1): 13–16. 10.1515 / CCLM.2004.004

    CAS Статья PubMed Google Scholar

  • 34.

    Гуань Ф., Ян Л.Г., Ан Дж.Т., Лю С.Р., Ши Г.К.: Разработка метода быстрой ПЦР с использованием тетрапраймера ARMS для обнаружения мутации гена BMPR-IB у овец. И Чуань 2005, 27 (4): 579–583.

    CAS PubMed Google Scholar

  • 35.

    Piccioli P, Serra M, Gismondi V, Pedemonte S, Loiacono F, Lastraioli S, Bertario L, De Angioletti M, Varesco L, Notaro R: Мультиплексная тетра-праймерная система устойчивых мутаций при амплификации ПЦР для обнаружения 6 распространенных мутаций зародышевой линии MUTYH ген, связанный с полипозом и колоректальным раком. Clin Chem 2006, 52 (4): 739–743. 10.1373 / Clinchem.2005.060137

    CAS Статья PubMed Google Scholar

  • 36.

    Ye S, Humphries S, Green F: специфическая для аллелей амплификация с помощью тетра-праймерной ПЦР. Nucleic Acids Res 1992, 20 (5): 1152. 10.1093 / nar / 20.5.1152

    PubMed Central CAS Статья PubMed Google Scholar

  • 37.

    Тетра-праймер ARMS-PCR [http://cedar.genetics.soton.ac.uk/public_html/primer1.html]

  • 38.

    Qi LL, Echalier B, Chao S, Lazo GR , Батлер Г.Е., Андерсон О.Д., Ахунов Э.Д., Дворжак Дж., Линкевич А.М., Ратнасири А., Дубковски Дж., Бермудес-Кандианис К.Э., Грин Р.А., Кантети Р., Ла Рота К.М., Мункволд Д.Д., Сорреллс С.Ф., Сорреллс М.Э., Дилбирлиги М., Сидху D, Erayman M, Randhawa HS, Sandhu D, Bondareva SN, Gill KS, Mahmoud AA, Ma XF, Miftahudin, Gustafson JP, Conley EJ, Nduati V, Gonzalez-Hernandez JL, Anderson JA, Peng JH, Lapitan NL, Hossain KG , Kalavacharla V, Kianian SF, Pathan MS, Zhang DS, Nguyen HT, Choi DW, Fenton RD, Close TJ, McGuire PE, Qualset CO, Gill BS: карта бункеров хромосом из 16000 локусов экспрессируемых последовательностей и распределение генов среди три генома полиплоидной пшеницы. Генетика 2004, 168 (2): 701–712. 10.1534 / genetics.104.034868

    PubMed Central CAS Статья PubMed Google Scholar

  • 39.

    Блейк Н.К., Шерман Дж. Д., Дворак Дж., Талберт Л. Е.: Геном-специфические наборы праймеров для генов биосинтеза крахмала в пшенице. Theor Appl Genet 2004, 109 (6): 1295–1302. 10.1007 / s00122-004-1743-4

    CAS Статья PubMed Google Scholar

  • 40.

    Праймеры, консервативные для пшеницы [http://wheat.pw.usda.gov/SNP/new/pcr_primers.shtml]

  • 41.

    BatchPrimer3 [http://wheat.pw.usda.gov/demos/BatchPrimer3/]

  • 42.

    Huo N, Gu YQ, Lazo GR, Vogel JP, Coleman-Derr D, Luo MC, Thilmony R, Garvin DF, Anderson OD: построение и описание двух библиотек ВАС из Brachypodium distachyon, новой модели для геномика травы. Геном 2006, 49 (9): 1099–1108. 10.1139 / G06-087

    CAS Статья PubMed Google Scholar

  • 43.

    Huo N, Lazo GR, Vogel JP, You FM, Ma Y, Hayden DM, Coleman-Derr D, Hill TA, Dvorak J, Anderson OD, Luo MC, Gu YQ: ядерный геном Brachypodium distachyon: анализ BAC-конца последовательности. Funct Integr Genomics 2008, 8 (2): 135–147. 10.1007 / s10142-007-0062-7

    CAS Статья PubMed Google Scholar

  • 44.

    Гарвин Д.Ф., Гу YQ, Хастерок Р., Хазен С.П., Дженкинс Г., Моклер Т.К., Мур А.Л., Фогель Дж.П.: Разработка ресурсов генетических и геномных исследований для Brachypodium distachyon, новой модельной системы для исследования травяных культур. Crop Sci 2008, 48: S69-S84. 10.2135 / cropci2007.06.0332tpg

    Артикул Google Scholar

  • 45.

    SSR-скрининг и праймеры в концевых последовательностях BAC Brachypodium [http://brachypodium.pw.usda.gov/SSR/]

  • Duratec Primer Инструкции по нанесению продукта от Hawkeye Industries — LBI Fiberglass Products

    Duratec Primer представляет собой многослойное полиэфирное покрытие, используемое для повторной полировки деталей из стекловолокна, требующих шлифовки и обтекания.ЭКОНОМИЯ НА ТРУДЕ! Отличная отделка заглушек и короткосерийных форм из фанеры, мазонита и т. Д.

    Инструкции по применению продукта от Hawkeye Industries

    Продукт: Duratec® Polyester Surfacing Primer (702-003 черный, 707-002 серый, 707-082 светло-серый, 714-002 белый)

    Используйте Duratec Polyester Surfacing Primer для грунтовки композитных заглушек и узоров и ряда деревянных изделий, включая те, которые используются для мебели, музыкальных инструментов и архитектурных приложений.

    Вот как наносить грунтовку Duratec Polyester Surfacing Primer: Примечание 1: Duratec Polyester EZ Sanding Primer является альтернативой Duratec Polyester Surfacing Primer. EZ Sanding Primer отверждается на воздухе быстрее и легче шлифуется, чем Surfacing Primer, а Surfacing Primer обеспечивает более прочное и глянцевое покрытие. Примечание 2: Если требуется более высокий блеск и вы решили не использовать верхнее покрытие, вы можете смешать грунтовку для поверхностного покрытия один к одному с добавкой Duratec Polyester Clear Hi-Gloss (904-001).

    1. Если никакой другой продукт Duratec не был сначала нанесен на основание, отшлифуйте всю поверхность наждачной бумагой с зернистостью 80 или 120 и вытрите начисто.Не используйте липкую тряпку.
    2. При нанесении грунтовки Duratec Polyester Surfacing Primer поверх Duratec Polyester Sealer шлифование не требуется. При нанесении грунтовки поверх Duratec Polyester Base Primer сформируйте и отшлифуйте поверхность наждачной бумагой с зернистостью 120 или 220 и вытрите начисто. Не используйте липкую тряпку.
    3. Тщательно перемешайте Duratec Polyester Surfacing Primer в баллончике перед катализацией — все наполнители должны быть полностью смешаны с жидкостью. Из-за быстрого гелеобразования грунтовки смешивайте только то количество, которое можно нанести в течение 15-20 минут.(Более высокие температуры приводят к более короткой жизнеспособности и времени гелеобразования, в то время как более низкие температуры приводят к более длительной жизнеспособности и времени гелеобразования.) Катализируйте 2% -ным катализатором mekP полной прочности (20 см3 на кварту). Разбавьте на 5-15 процентов, если необходимо, до желаемой вязкости распыления с помощью Duratec Thinner (39LAC-1) или МЕХ растворителя после катализа.
      1. Примечания к оборудованию: Для распыления можно использовать гравитационные, сифонные или напорные системы распыления. Для гравитационных и сифонных пистолетов требуется давление в линии 35-50 фунтов на квадратный дюйм и 1.Сопло 5-2,5 мм. Для систем нагнетательного бака требуется давление в баке 12-15 фунтов на квадратный дюйм и линейное давление
        35-50 фунтов на квадратный дюйм.
    4. Нанесите «липкое покрытие» на всю поверхность и дайте ему высохнуть в течение 2 минут. Затем выполняйте влажные проходы, медленно наращивая до желаемой толщины (10-40 мил, 250-1000 микрон). Большей толщины можно добиться, повторяя процесс сразу после образования геля, примерно каждые 2 минуты. Грунтовка высохнет на ощупь через 2-4 часа, в зависимости от толщины и температуры, и будет готова к шлифовке в течение 2-4 часов.
    5. Сухая шлифовка всей поверхности наждачной бумагой зернистостью 180 или 220. Протрите поверхность чистой белой тканью или бумажным полотенцем. Не используйте липкую тряпку. Повторите процесс, если требуется дополнительная грунтовка для поверхностного покрытия.

    Kilobaser Примечание по применению: Характеристики праймера ДНК — Kilobaser

    Сводка


    Для анализа эффективности праймеров, напечатанных с помощью машины Kilobaser, мы сравнили реакцию ПЦР с праймерами Kilobaser с праймерами, купленными у стандартного поставщика.При окончательном анализе фрагментов ПЦР на агарозном геле различий не заметно.

    Введение


    ПЦР колоний

    ПЦР колоний — это процесс отбора одной колонии бактерий и проведения ПЦР на бактериях, чтобы определить, несут ли они интересующий ген. Поэтому бактерии разводят в стерильной воде и добавляют в реакционную смесь для ПЦР. Тепло ПЦР разрушит бактерии, поэтому предварительная экстракция ДНК не требуется.

    Бактериальные искусственные хромосомы

    Для обработки фрагментов ДНК и их репликации в бактериях обычно используются плазмиды.Для больших фрагментов ДНК плазмиды могут иметь слишком маленький размер полезной нагрузки, и тогда используются бактериальные искусственные хромосомы (ВАС). Стандартная плазмида pUC, по-видимому, содержит максимум 15000 пар оснований ДНК, но точная полезная нагрузка, по-видимому, зависит от других факторов, таких как фактическая последовательность. Распространенной бактериальной искусственной хромосомой является pBelobac11, которая может содержать до 300 000 пар оснований ДНК. Чтобы прочитать всю ДНК человека в проекте генома человека, ДНК человека случайным образом разрезали на части с использованием рестрикционных ферментов, а затем фрагменты лигировали в ВАС.ВАС содержит известные последовательности, и, таким образом, можно выполнить секвенирование фрагментов по Сэнгеру.

    Материалы и методы


    Чтобы убедиться, что бактерии все еще содержат бактериальную искусственную хромосому, мы провели ПЦР колонии одной колонии E. coli.

    ХВ-UL30-F 5 ‘atcaacttcgactggccctt
    ХВ-UL30-R 5′ ccgtacatgtcgatgttcac

    дс 5 ‘tcaccatggagtttacgggc
    дс 5′ gtactcggtctgctcgtacg

    UL6-F gacgtcagcaagtccatgga

    UL6-р ggcgcagaatcttgaagcag

    Мы взяли колонию из стерильной инокуляционной петлей и поместите их в 300 мкл деионизированной воды в автоклаве.Впоследствии мы взяли 1 мкл раствора в качестве шаблона и поместили его в 50 мкл смеси для ПЦР. Затем фрагменты ПЦР помещали в 1% агарозный гель и разделяли по размеру.

    Были напечатаны 300 пмоль праймеров, которые затем разбавили 30 мкл воды, свободной от нуклеаз. Отбирали по 1 мкл каждого полученного праймера 10 пмоль / мкл и добавляли к реакции ПЦР.

    Mastermix

    Прямой праймер (~ 10 пмоль) (Kilobaser или Eurofins)

    Обратный праймер (~ 10 пмоль) (Kilobaser или Eurofins)

    1 мкл шаблона (бактерии)

    2x Dream Taq PCR Mix

    профиль циклирования

    ДНК амплифицируется в типичном цикле ПЦР, создавая повторяющиеся циклы с чередующимися периодами температуры.

    Был использован следующий профиль:

    Шаг 1: 95 ° C в течение 1,5 минут

    Шаг 2: 95 ° C в течение 30 секунд

    Шаг 3: 53 ° C в течение 30 секунд

    Шаг 4: 72 ° C для 1 мин.

    Шаг 5: перейти к Шагу 2; 38 повторов

    Шаг 6: 72 ° C в течение 10 минут

    Эту реакцию проводили в течение 38 циклов.


    Результаты


    На рис. 1 показан полученный гель агарозы на трансиллюминаторе. Полосы были следующими: лестница 100 п.н., UL30 с праймерами другой компании, UL30 с праймерами Kilobaser, Lambda-Hind ladder, gC с праймерами другой компании, gC с праймерами Kilobaser, UL6 с праймерами другой компании, UL6 с праймерами Kilobaser. .Праймеры UL30 были разработаны для создания полосы 179 п.н. Последняя четко видимая полоса лямбда-задней лестницы составляет 2027 п.н., и продукт ПЦР явно ниже этого значения. Оказалось, что это где-то между стандартами 100 и 200 б.п. Мы ожидали, что праймеры для gC создадут полосу 197 п.н., вместо этого они дали полосу, которая должна находиться на нижнем конце между 1500 и 2000 п.о. при сравнении с лестницей 100 п.н. Однако реакция сработала стабильно с праймерами от Kilobaser и стандартной компании-поставщика услуг.Придется проанализировать конструкцию грунтовки или попробовать разные температуры для этого. Ожидается, что продукт ПЦР UL6 будет иметь длину 142 п.о., что соответствует лестнице 100 п.н.

    Как наносить грунтовку (и когда ее использовать)

    Мы слышим вас: мы все голодны по времени больше, чем когда-либо, и иногда даже просто нанесение макияжа может казаться достижением! А когда у вас мало времени, добавление праймера просто кажется шагом, который нужно отложить для особых событий.

    Стоит ли вообще добавлять праймер в повседневную жизнь? Если да, то когда? Выделение места для этого шага (предупреждение о спойлере: необходимо) может окупиться несколькими способами.Продолжайте читать, чтобы получить ответы на свои учебные вопросы!

    Что такое праймер и зачем его использовать?

    Макияж покрывает цвет, а не текстуру. Это означает, что если вы не начинаете с идеально гладкого полотна (предупреждение о спойлере: большинство из нас таковыми не являются), грунтовка может помочь вашей коже получить то место, где она должна быть, прежде чем вы нанесете стежок тонального крема. Праймер — это самый последний шаг перед нанесением средств для ухода за лицом, он подготавливает (и грунтует) кожу для макияжа.

    Когда следует наносить грунтовку?

    Праймер для лица — лучший помощник вашего тонального крема — ничего не должно быть между ними.Нанесите увлажняющий крем, затем нанесите праймер, а затем нанесите тональный крем или консилер. Независимо от того, покрываете ли вы лицо или веки, вы настраиваете себя на успех, фиксируя взгляд.

    Какая грунтовка мне подходит?

    Выбор лучшего праймера — это все, что нужно для вашей кожи. Если у вас жирная кожа, вам понадобится праймер, который матирует и помогает контролировать жир. Это важно, поскольку создает барьер между кожей и макияжем, не позволяя маслам портить ваш внешний вид в течение дня.

    Если у вас текстурированная кожа, важно использовать праймер, который разглаживает и заполняет линии, чтобы тональный крем мог легко скользить по вашему лицу. Силикон — отличный ингредиент для этой цели — и, хотите верьте, хотите нет, это вовсе не злой ингредиент, как его выдумали.

    Primer продлевает стойкость любого образа, а польза не только для вашей кожи! Праймер для век не только закрепляет ваши любимые тени на месте, но и делает цвета более яркими и предотвращает появление складок и выцветания в течение дня.

    Как нанести грунтовку?

    Обязательно выполните все обычные действия по уходу за кожей перед нанесением праймера. Для получения максимального эффекта грунтовка и основа должны лежать на лице рядом, и никакие другие продукты не должны попадать между этими двумя слоями.

    Количество праймера, которое вы наносите, зависит от типа, который вы используете, но обычно небольшое количество идеально подходит для всего лица. Если вы используете матирующую формулу, используйте только те участки, которые становятся жирными в течение дня.Для большинства других формул нанесите небольшое количество средства на лицо и подождите около минуты, прежде чем наносить тональный крем или консилер. Это даст праймеру время схватиться и будет работать с вашим макияжем, а не против него.

    Наносите ли вы пальцами или своей любимой кистью для тонального крема, перед нанесением основы убедитесь, что ваш праймер равномерно растушевался.

    Праймер для глаз рекомендуется наносить по одному глазу за раз. На обе крышки хватит порции размером с горошину. Кончиками пальцев равномерно нанесите праймер на крышку.Дайте праймеру застыть на несколько секунд, чтобы у вас была гладкая поверхность, а тени не прилипли.

    Smooth Sailing Perfecting Primer — идеальный выбор для матирования, минимизации пор и размытия несовершенств для плавного плавания в течение всего дня. Легкая формула легко вписывается в кожу, оставляя после себя ровный холст, который обеспечивает шелковистую гладкость при нанесении макияжа и длительного ношения. Подвешенные золотые хлопья помогают повысить эластичность и сделать кожу более здоровой.

    Smooth Sailing 360 ° Eye Primer — это шелковистая, легкая грунтовка, которую можно наносить на всю область вокруг глаз (включая область под глазами, надбровные дуги и веко), чтобы продлить стойкость и пигментацию теней или консилера.Праймер, защищающий от складок и разводов, уменьшает вид тонких линий и сглаживает нежелательную текстуру на коже, сохраняя при этом ваш образ.

    Итак, у вас будет время для расцветки? Поделитесь с нами своей позицией по праймеру на @wander_beauty!

    Как наносить грунтовку и что такое грунтовка?

    Что делает грунтовка

    Праймер для лица наносится под макияж, чтобы помочь макияжу оставаться на месте и придать цвету лица ровный оттенок кожи, придать ей сияние и получить дополнительные преимущества для кожи.Вы также можете нанести праймер поверх макияжа, чтобы мгновенно оживить кожу в течение дня. Нам нравится использовать Wonderglow, чтобы освежить ваш макияж. Или, если у вас великолепный цвет лица, нанесение праймера для лица само по себе поможет выровнять тон кожи и размыть пятна для повседневного, естественно сияющего образа.

    Почему следует использовать грунтовку

    Если вы хотите добиться более гладкого сияющего цвета лица, то праймер просто необходим в вашей косметичке. В зависимости от типа праймера вы можете получить множество различных преимуществ по уходу за кожей, а также сделать макияж сияющим.Являясь гибридом средств для ухода за кожей и макияжа, он является идеальным средством, позволяющим сохранить безупречный вид вашей кожи.

    Преимущества грунтовки

    Праймер для лица не только полезен для ухода за кожей, но и является незаменимым продуктом для макияжа. Это делает его идеальным началом процедуры макияжа, который может обработать и преобразить вашу кожу!

    Антивозрастной

    Мы все ищем тот эликсир молодости, и праймер для лица может его доставить! Праймер с антивозрастными ингредиентами может создать иллюзию сияния молодости.Благодаря защитным ингредиентам, таким как пептид BioNymph, ваша кожа всегда будет выглядеть молодой и свежей.

    Освещение

    Ни для кого не секрет, что в Charlotte Tilbury мы все стремимся к сиянию, поэтому осветляющий праймер занимает одно из первых мест в нашем списке приоритетов макияжа и ухода за кожей! Праймеры идеально подходят для придания легкого сияния под макияж, если вы хотите придать ему сияние. Если вы хотите нанести праймер отдельно, осветляющие ингредиенты могут дать вам полное сияние без интенсивности хайлайтера.Нам нравится придавать дополнительный импульс нашему полуденному макияжу, нанося праймер Wonderglow) на наши скулы для создания тонких бликов.

    Сглаживание

    Праймер для лица и гладкая кожа идут рука об руку. Самый популярный способ использования грунтовки — перед нанесением основы, и это фантастический метод создания гладкого полотна. Поскольку ингредиенты для ухода за кожей ухаживают за вашей кожей, разглаживающий макияж создает шелковистую мягкую кожу, которая помогает макияжу легко скользить по вашему лицу. Кроме того, это помогает макияжу держаться дольше!

    Коррекция цвета

    У многих из нас есть проблемы с покраснением и изменением цвета кожи.Праймеры для лица — прекрасное средство, которое поможет выровнять тон кожи и скорректировать любые покраснения. Сделав это перед нанесением тонального крема или консилера, вы сможете избавиться от обесцвечивания. Это поможет вам понять, где вам нужно дополнительное покрытие с помощью макияжа, а где можно обойтись без него. Наша праймер «Осветляющее сияние молодости» специально разработан для коррекции цвета и выравнивания тона кожи!

    Увлажняющий

    Увлажненная, увлажненная кожа стоит на первом месте в наших списках желаний по уходу за кожей.Используя праймер для лица, вы можете помочь сохранить кожу питательной и увлажненной. В течение долгих дней и более длинных ночей праймер для лица — незаменимый шаг в уходе за кожей и макияже, так что вы можете сохранить свой макияж безупречным.

    Как наносить грунтовку

    Как нанесение грунтовки может повысить или снизить эффективность вашего клея

    Нанесение грунтовки для автомобильной промышленности

    Вы можете этого не осознавать, но клеи широко используются в автомобилях, они отвечают за крепление всего, от отделки кузова и спойлеров до лобовых стекол, фар и задних фонарей.Но адгезивы зависят от грунтовок, чтобы они работали должным образом, и нанесение грунтовок на детали кузова и стекло представляет собой особые проблемы из-за разнообразия клеев, которые могут быть использованы, а также важности безопасности и эстетики. Чтобы соответствовать строгим стандартам качества для современных автомобилей, грунтовку необходимо наносить аккуратно и многократно, в нужном количестве и без ущерба для эстетики автомобиля.

    Что такое грунтовка?
    Грунтовка — это общий термин для вещества, которое очищает и подготавливает поверхность для нанесения покрытия, такого как клей или краска.Грунтовки очищают основу от загрязнений, мусора и частиц, которые могут вызвать дефекты покрытия. Они также могут изменять характеристики подложки и служить связующим слоем.

    Праймеры для тела

    Грунтовки, используемые в автомобильной промышленности, обычно делятся на две категории: грунтовки для кузова и грунтовки для стекла. Грунтовки для кузова в основном имеют черный цвет и содержат смесь растворителей и твердых веществ. Это означает, что грунтовку необходимо перемешивать до и во время использования — в противном случае твердые частицы могут отделиться от растворителя и вызвать закупорку аппликатора.Если это произойдет, возможно, не будет нанесен правильный состав грунтовки, и клей может не работать должным образом, что может привести к катастрофическому отказу.

    Когда черный праймер наносится ручным аппликатором, перемешивание облегчается за счет обычного обращения с флаконом. Но когда используется автоматизированная или полуавтоматическая система внесения жидкости, важно убедиться, что система обеспечивает способ перемешивания. Вот почему Designetics разработала держатель для бутылок с мешалкой.

    Держатель для бутылок с перемешивающей пластиной обеспечивает герметичное уплотнение с контейнером для грунтовки и постоянно перемешивает грунтовку, чтобы твердые частицы оставались взвешенными в растворителе, обеспечивая правильную работу грунтовки и избегая отходов. HMI (человеко-машинный интерфейс) аппликаторной системы отображает гистограмму, показывающую процент заполнения бутылки. Это позволяет оператору контролировать уровень жидкости в баллоне с праймером, поэтому необходимость замены может быть спрогнозирована и завершена в оптимальное время, не прерывая производства.

    Емкость с праймером или бутыль из одобренного Designetics HDPE опирается на перемешивающую пластину, в корпусе которой находится магнитное рабочее колесо. Для перемешивания в держателе бутылок с мешалкой используется один из двух методов. Если в баллоне есть внутренний стальной шарик, движение крыльчатки заставляет шарик перемешивать заливочную жидкость. В качестве альтернативы, если в баллоне нет стального шара, внутрь баллона с праймером помещается магнитная «таблетка», и крыльчатка воздействует на магнитную таблетку, как стальной шарик.Скорость крыльчатки и, следовательно, скорость перемешивания можно настроить через HMI аппликаторной системы.

    Но гарантировать, что черные грунтовки достаточно перемешаны, — это только полдела. Правильное нанесение грунтовки для черного тела также имеет решающее значение. При неправильном нанесении черный грунт может быть трудно, а иногда и невозможно удалить. Неправильное нанесение черной грунтовки обычно требует, чтобы деталь была отключена, чтобы грунтовка была удалена вручную — серьезный сбой, который снижает производительность, увеличивает количество брака и приводит к более высоким производственным затратам.

    Держатель для бутылок с перемешивающей пластиной обеспечивает правильное перемешивание черных грунтовок до и во время нанесения.

    Грунтовка для стекла

    Нанесение грунтовки на автомобильное стекло создает особые проблемы из-за гладкости стекла и важности эстетики. Нанесение грунтовки для стекла — это двухэтапный процесс, в котором сначала наносится прозрачная жидкость на основе растворителя, действующая как очиститель или активатор, перед нанесением черной грунтовки.

    Прозрачную жидкость следует наносить равномерно и в минимально возможном количестве, чтобы она быстро высыхала.Но его также необходимо наносить в количестве, которое будет эффективным, в соответствии с инструкциями, предоставленными производителем химиката, и TDS (Техническим паспортом) химического вещества. Время высыхания прозрачной жидкости должно позволить ей «испариться» (высохнуть) перед нанесением черной грунтовки. Это означает, что чрезмерное нанесение прозрачной жидкости на основе растворителя может значительно увеличить время цикла, поскольку время выдержки является решающим фактором в процессе нанесения.

    Например, если прозрачная жидкость на основе растворителя наносится по длине стекла от точки A до точки B, жидкость в точке A или около нее должна вылиться к тому времени, когда аппликатор достигнет точки B.Это гарантирует, что прозрачная жидкость будет достаточно «сухой», но все же эффективной, когда аппликатор будет готов начать нанесение черной грунтовки.

    Нанесение черной грунтовки на автомобильные стекла связано с различными проблемами. Во-первых, при неправильном и неправильном нанесении черная грунтовка может вызвать так называемые «полосы зебры» или «эффект зебры» — состояние, при котором на грунтовочном покрытии остаются зазоры или полосы. Это не только некрасиво, но и ухудшает адгезию.

    При нанесении черной грунтовки также важно использовать такое же давление, какое необходимо для жидкости и аппликатора.Слишком большое давление во время нанесения может привести к так называемому «эффекту снежного плуга». Это происходит, когда прижимная сила во время нанесения слишком велика, и грунтовка накапливается с внешней стороны нанесения, оставляя полосы в середине и гораздо большую толщину на концах. Эффект снегоочистителя может быть особенно пагубным, так как может привести к расслоению склеивания стекла.

    Нанесение грунтовок на детали кузова и стекло связано с особыми проблемами из-за разнообразия используемых грунтовок, а также важности безопасности и эстетики.
    Аппликаторы для каждой работы

    Так же, как не существует «единственного лучшего» праймера, лучший аппликатор зависит от множества факторов. В Designetics наши региональные торговые представители и инженеры понимают технические, качественные и эстетические факторы, которые необходимо учитывать при выборе аппликатора для использования в автомобильной промышленности. Обладая этими знаниями и опытом, мы можем «выбрать» лучший аппликатор на основе грунтовки, ее вязкости и времени высыхания, а также основы.У нас есть более 5000 запатентованных аппликаторов для нанесения жидкости, чтобы удовлетворить практически любые требования, и мы можем разработать индивидуальные аппликаторы и автоматизированные системы, чтобы вы получили решение, обеспечивающее точную и повторяемую подачу грунтовки.

    Чтобы узнать больше о наших аппликаторах жидкости и автоматизированных системах, свяжитесь с нами. Designetics ориентирована на предоставление комплексных решений, и мы хотели бы узнать о вашем нанесении грунтовки и помочь вам сократить время производства, сократить количество отходов или даже перейти от ручного к полуавтоматическому или автоматическому процессу нанесения жидкости.

    Теги: нанесение праймера

    10 преимуществ использования праймера для макияжа

    Правильный макияж — это искусство. Требуются особые навыки, подходящие инструменты и подходящий набор косметических средств, чтобы подчеркнуть ваши лучшие черты и при этом преуменьшить недостатки и недостатки. В стремлении к совершенству праймер для макияжа стал одним из самых полезных продуктов для подготовки кожи к нанесению макияжа.

    Что такое праймер для макияжа?

    Праймер для макияжа применяется для подготовки поверхности кожи к нанесению различных слоев и различных типов макияжа.Нанесение праймера для макияжа похоже на подготовку чистого холста для рисунка. Праймеры сделаны из восков, силиконов и полимеров, обогащенных различными комбинациями витаминов, минералов, антиоксидантов и смягчающих веществ. Наносится после увлажняющего крема, но до тонального крема.

    Преимущества использования праймера для макияжа

    Состояние вашей кожи зависит от климата, режима ухода за кожей и общего состояния здоровья. К счастью, состояние вашей кожи можно изменить с помощью волшебных средств по уходу за кожей и косметики.В этом отношении нанесение праймера под макияж может иметь много преимуществ.

    1. Смягчитель кожи

    Праймеры для макияжа, содержащие смягчающие вещества, обогащенные витаминами, оказывают увлажняющее действие на кожу, улучшая текстуру и обеспечивая более гладкую поверхность для нанесения макияжа. The Present Clear Makeup от Philosophy — это многозадачный праймер для макияжа, который создает бархатистую поверхность, благодаря которой косметика лучше скользит по ней.

    2. Минимизатор пор

    Увлажняющие средства разработаны для оптимального впитывания кожи.Если тональный крем наносится сразу после увлажняющего крема, ваши поры могут просвечивать сквозь тональный крем. Эту проблему решит нанесение праймера для макияжа, такого как Too Faced Primed & Poreless Pure-Free Skin Smoothing Face Primer.

    3. Некомедогенное уплотнение пор

    Эффективные праймеры под макияж создают на лице шелковистую поверхность, поскольку закрывают поры. Тем не менее, придерживайтесь некомедогенных составов, которые не закупоривают поры и не вызывают раздражения кожи, например, Age Smart Skin Perfect Primer от Dermalogica.

    4. Антивозрастной эффект

    Некоторые праймеры для лица могут содержать антиоксиданты и другие антивозрастные ингредиенты. Тем не менее, сияние молодости, которое достигается за счет включения праймера для макияжа в вашу повседневную жизнь, происходит благодаря полирующему эффекту праймеров для кожи. Хотя эффект носит временный характер, нанесение грунтовки минимизирует морщинки при нанесении. Однако такие продукты, как Skin Perfector Anti-Wrinkle и Firming Primer от Dermablend, при регулярном использовании могут помочь сделать кожу более молодой и выглядеть более молодой.

    5. Уменьшение покраснения и признаки угревой сыпи

    Праймеры для чувствительной кожи содержат успокаивающие компоненты. Хотя праймеры не предназначены для лечения прыщей, использование этого продукта под тональный крем поможет скрыть неприглядные прыщи. Сияние кожи возможно благодаря смеси экстрактов огурца, кактуса и антиоксидантов в Skin Calming Face Primer SPF 20 от Colorscience.

    6. Матирование и предотвращение шелушения

    Хотя некоторые праймеры могут увлажнять кожу, другие созданы для уменьшения жирности, которая может привести к появлению полос на макияже.Праймеры также предотвратят впитывание талька из средств макияжа.

    7. Более полированный макияж

    Если смотреть на свой рутинный макияж с бархатистой канвы, макияж наносится легче, создавая профессиональный вид на лице.

    8. Макияж остается дольше

    Плотность кожи лица сводится к минимуму, поскольку грунтовка действует как временный герметик для пор.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *