Как сделать самому грунтовку глубокого проникновения: Страница не найдена

Содержание

Как сделать грунтовку для стен своими руками: Обзор +Видео

Как сделать грунтовку для стен своими руками. Чтобы отделочный слой в виде декоративной штукатурки или краски смог продержаться на стене как можно дольше, перед тем, как проводить отделочные работы требуется для начала покрыть стену слоем грунтовки. В строительном супермаркете на данный момент в продаже есть огромное количество разновидностей грунтовки, которую выпускают множество производителей.

Но далеко не каждый человек знает о том, как сделать грунтовку своими руками, у которой будет себестоимость намного ниже, нежели у готовой.

Какую пользу дает грунтовочная смесь

Как было указано выше, грунтовочная смесь помогает продлить срок эксплуатации настенного покрытия, а также улучшает качество сцепления отделочного материала и поверхности стен. грунтовка – это жидкая смесь, которую наносят на поверхность стен равномерным слоем, а по мере просыхания она создает плотную пленку, на которую будет отлично ложиться краска, штукатурка, обои и другие типы покрытий.

Если с поверхности стен в вашей квартире или доме сыпется штукатурка, а сам по себе стены ветхие и рыхлые, то в таком случае штукатурка поможет укрепить их дополнительно в тандеме с грунтовкой.

Исходя из того, какие функции обязательно будет выполнять грунтовка, ее можно поделить на такие разновидности:

  • Грунтовка, которая повышает качество сцепления наносимого материала с поверхности стен.
  • Грунтовочная смесь, которая укрепляет стены.
  • Грунтовка с глубоким проникновением, которая имеет водоотталикивающее и защитное воздействие.

Более того, грунтовка имеет антисептические и антикоррозийные свойства. В определенных составах использование дополнительных компонентов может придать поверхности еще и огнеупорность.

 

Обратите внимание, что стоит знать о том, что обработка грунтовкой рабочей поверхности требуется практически для всех отделочных работ, к примеру, при штукатурке газобетонных и пенобетонных стен, покрасочных работ вроде окрашивания бетонного пола или даже шифера.

Итак, перед тем приготовить самостоятельно в домашних условиях грунтовку, следует определиться с тем, какие она должна выполнять функции, так как именно от этого будет зависеть ее дальнейший состав.

Как сделать самостоятельно грунтовку

Вопрос о том, как сделать самостоятельно грунтовочную смесь для поверхности стен, на данный момент волнует многих людей. А ведь казалось, что такого, если можно просто отправиться в ближайший строительный маркет и купить готовый раствор? Но если повнимательнее присмотреться к стенам, то вы поймете, что есть разница, и причем большая. Грунтовка состоит из очень недорогих и простых компонентов. Самое важное, чтобы состав был правильно подобран и рассчитано в точности количество всех элементов.

Как сделать грунтовочную смесь, которая повысит прочность стен

Для приготовления состава для грунтования поверхности вам потребуется взять такие компоненты:

  • 1 мера медного купороса.
  • 5 мер костного клея столярного.
  • 2 меры хозяйственного мыла 60%.

Кастрюля подходящего размера или эмалированное ведро. В идеале посуда должна быть ненужной для будущего, потому что после приготовления такого раствора в посуде нельзя будет готовить еду.

А теперь пошаговая инструкция:

  1. Наберите в емкость холодную воду, а после доведите ее до кипения.
  2. Заранее измельчите хозяйственное мыло, а лучше натрите на обычной кухонной терке – тогда не потребуется долго ждать, чтобы оно полностью успело раствориться.
  3. Полученную мыльную крошку следует высыпать в кастрюлю, поставить огонь на минимум, а после несколько минут помешивать мыльные стружки в воде деревянной палкой или лопаткой, до тех пор, пока мыло не раствориться полностью.
  4. Для того, чтобы сделать грунтовку своими руками, добавьте в получившийся раствор медный купорос и столярный клей.
  5. Далее емкость следует накрыть крышкой, оставить вариться на медленном огне примерно 30 минут. Смесь требуется время от времени помешивать, чтобы не получились комочки.
  6. Когда пройдут отведенные полчаса, снимите раствор с огня, немного его остудите и процедите, пока он еще горячий через несколько слоев марли или сито.
  7. Когда полностью высохнет раствор, его можно начинать наносить на стены.

Полезный совет! Если во время варки вы упустите момент и в растворе все-таки образуются комочки, то можно будет от них избавиться, если использовать стандартный миксер или даже погружной блендер. Но будьте бдительны, чтобы техника не сломалась. Сразу после того, как вы вытащите миксер из раствора, следует его хорошо промыть.

Как сделать грунтовочную смесь с глубоким проникновением своими руками

Чтобы обеспечить стен родного дома или квартиры защиту от неблагоприятных условий окружающей среды, требуется использовать грунтовку с глубоким проникновением, которая чаще всего делают на основе ПВА клея. Для создания грунтовки глубокого проникновения нужно будет купить строительный ПВА клей, который идеально будет справляться с задачей повышения прочности стен и их водонепроницаемости.

Хотя может казаться, что при таких полезный свойствах строительного клея ПВА им можно было бы заменить  и грунтовку. Но такое категорически нельзя делать, так как клей ПВА на поверхности стен способен образовать влагонепроницаемую пленку, которая спустя время начнет отслаиваться вместе со слоем штукатурки. Более того, вы наверняка еще со школы помните о том, что клей ПВА имеет свойства начинать  желтеть спустя какое-то время, а это негативным образом сказывается на внешней виде отделки,  в частности на обоях. По этой причине клей ПВА обязательно должен быть использовать, но не в качестве основного элемента, а лишь в роли добавки.

Как сделать грунтовку из ПВА клея

Сделать грунтовку из ПВА клея достаточно просто, и для этого вам потребуются такие компоненты:

  • 1 мера строительного ПВА клея.
  • 8 мер воды.
  • Немного цемента.

От вас потребуется немногое – смешать с водой клей, добавить цемент в смесь, все хорошо смешать между собой, а после процедить через несколько слоев марли или сито. Достоинством такого способа будет то, что приготовление грунтовки своими руками простое, удобное, а также нет необходимости затрачивать время на то, чтобы для начала довести до кипения смесь, после сварить, а дальше дождаться, пока все остынет. грунтовка, сделанная на основе клея ПВА будет готова к использованию сразу после того, как вы процедите готовый раствор. Единственным недостаток будет то, что хранить ее можно будет не более, чем сутки, поэтому запастись таким раствором впрок не получится.

Также существует небольшая хитрость для того, чтобы можно было определить, правильно ли выдержаны пропорции клея, цемента и воды, которые были использованы. Перед тем, как начать обработку стен грунтовочным раствором, следует нанести его на малый участок стены и дать просохнуть. Если в результате на поверхности участка не появилась плотная пленка, то пропорции были взяты правильно, и можно начинать процесс грунтования.

Как сделать грунтовочную смесь для дерева

Среди остальных материалов обработка древесины, пожалуй, является одной из самых сложных задач. Для начала вам потребуется разобраться с тем, в каких случаях древесину вообще следует грунтовать, а когда можно лишь покрывать поверхность особой пропиткой.

Выполнить грунтование древесины требуется, если:

  • Деревянная поверхность является частью фасада здания снаружи или же соприкасается со стенами, которые выходят наружу.
  • Если на деревянной поверхности есть какие-либо дефекты, которые просто не получится удалить без использования шпаклевки и скрыть без окрашивания.
  • Если деревянная поверхность находится в сыром и неотапливаемом помещении.
  • Если дерево хочется в будущем покрыть слоем краски или лака.

Для дополнительной защиты деревянного покрытия обычно используют акриловые, алкидные, шеллаковые и антисептические грунтовки, но они особенные, и браться за их самостоятельное изготовление будет рискован. Древесина является достаточно капризным материалом, и если экспериментировать с ним, используя разные типы грунтовок, есть большая вероятность повредить материал. Поэтому в таком случае лучше использовать готовые растворы для грунтования.

Как сделать грунтовку под обои

Некоторые из домашних мастеров смогли сэкономить много средств и вместе с тем облегчит жизнь, просто объединив обойный клей и грунтовочную смеси в едином растворе. В таком случае клей для обоев будет играть роль альтернативной замены строительного ПВА, так как обладает похожими физическими свойствами и глубиной проникновения. Еще одним достоинством замены клея ПВА на тот, что для обоев, является то, что не потребуется ждать, пока высохнет слой грунтовки. Как только вы обработаете участок стены при помощи клея для обоев, то можно будет сразу же прикладывать к нему лист обоев нужного размера.

И в конце расскажем немного о том, как правильно наносить грунтовочный слой:

  1. Перед тем, как начать процесс грунтования, заранее следует подготовить всю поверхность – удалить с нее остатки старого покрытия, пыль и другой мусор.
  2. Грунтовку будет удобнее всего наносить, если использовать валик, и окунать его в особую ванночку из пластика, которая за счет наличия в ней особой ребристой поверхности не даст валику впитать лишний раствор. Углы и остальные места, которые являются труднодоступными, лучше обработать при помощи кисти.

Кроме того, специалисты советуют наносить слой грунтовку одним и размашистым движением руки, снизу вверх. Постарайтесь ее нанести так, чтобы валик не проходил по одному и тому же месту два раза, так как в противном случае слой грунтовочной смеси получится неравномерным. Чтобы слой был плотнее, дайте для начала высохнуть первому слою, и только после этого можно будет наносить и второй, и следующие слои.

экономия и уверенность в качестве

Современные технологии производства могут представить достаточно разнообразный ассортимент грунтовки для пола различного качества, по приемлемой цене и для любого назначения. Но, в определённых ситуациях можно прилично сэкономить деньги и приготовить не самый худший состав своими руками.

Как показывают статистические исследования, наибольшей востребованностью пользуются самодельная акриловая смесь и грунтовка с водозащитными свойствами глубокого проникновения, сделанная на основе ПВА.

Рассмотрим подробнее процессы изготовления этих двух вариантов:

1.

Самодельная акриловая грунтовка

Немного окунувшись в историю создания акриловых грунтовок, можно увидеть, что изначально в ней присутствовали всевозможные добавки и пигменты, которые делали её укрывистой по аналогии с настоящей краской. Если покрывать неровный пол такой грунтовкой, то она способна выровнять не только цвет, но и общую структуру.

Для оформления современного декора, такими составами пользуются в основном художественные декораторы для эксклюзивной росписи. Рисунок в помещении, выполненный на светлом тоне подложке, выглядит эффективнее и ярче.

Для классических строительных потребностей подойдёт больше грунтовка без окраски (бесцветная), а создать желаемый тон можно с первым нанесённым слоем краски.

Рецепт акриловой грунтовки своими руками

Основные компоненты, которые входят в состав:

— вода очищенная – 87,10%;

— связующее вещество – 12,0%;

— биоцид – 0,12%;

— коалесцент – 0,49%;

— пеногаситель – 0,29%.

В случае когда связующее вещество не образует пены, то вполне реально можно обойтись без применения пеногасителя. Также, если грунтовку не планируется долго (6–9 дней) хранить, можно не добавлять биоцид, который уничтожает вредителей и бактерии.

Вещество коалесцент обладает свойством понижать минимальное значение температуры, чтобы формировалась плёнка. Когда её значение не больше +6С, его можно не прибавлять в общую массу. Остаётся сделать дисперсию из компонентов и развести нужным количеством воды.

Предположим, нужно загрунтовать определённую площадь пола, который плохо впитывает влагу. Часто, в этом случае, грунтовка собирается в виде толстой плёнки, небольшими пятнами, на поверхности. Такую проблему можно легко исправить путём добавления в состав веществ, обладающим поверхностно-активным действием. Несмотря на сложность формулирования, это довольно легко!

Секрет! К самым лучшим и безопасным поверхностно-активным веществам относится 72% хозяйственное мыло! Есть специальные добавки, но они очень дорогие. Эффективнее использовать мыло, которое стоит копейки!

Мы получили хорошую акриловую грунтовку, которая хорошо держится на обрабатываемой поверхности, из-за хозяйственного мыла.

Хорошо бы улучшить качество и сделать хорошую защиту пола от грибка и плесени следует добавить медный купорос или фунгицид – в итоге проблема решена!

Чтобы подложка лучше впитывала грунтовую смесь, в её основе следует применять связующее вещество с тонкодисперсионной структурой. Только в таком случае можно достигнуть процентного содержания с 13% до 52%.

Суммируя все новые различия, получается ИННОВАЦИОННАЯ РЕЦЕПТУРА АКРИЛОВОЙ ГРУНТОВКИ:

— вода очищенная – 45,6%;

— связующее тонкодисперсионное – 50,1%;

— фунгицид (или медный купорос) – 1,1%;

— поверхностно-активные соединения – 0,4%;

— коалесцент (если нужно) – 2,5%;

— пеногаситель (если есть необходимость) – 0,3%.

Конечно, этот вариант стоит больше, чем классический состав, но по эффективности будет превосходить большинство заводских дорогостоящих вариантов.

2. ПВА-грунтовка своими руками

Если понадобится глубоко проникающая грунтовка за небольшую цену, то её вполне можно изготовить из клея ПВА. Но клей необходимо использовать только из ПВА-строительный, а не канцелярский вариант. Независимо от этого, грунтовка будет стоить во много раз дешевле, чем самая дешёвая покупная (готовая).

Для основания пола, грунтовка с самодельным составом (основанном на ПВА) может создать качественный гидрофобный слой защиты, улучшенную адгезию материалов. Она имеет возможность проникать в глубину структуры материала.

Цена грунтовки напрямую зависит от глубины проникновения в бетонную (деревянную) структуру – чем глубже, тем дороже! Учитывая этот аспект, можно сильно сэкономить, но в качестве придётся незначительно уступить.

Вариант с ПВА-смесью является наиболее бюджетным, в принципе вполне подходит для домашнего строительства (ванная, гараж, кухня).

Инструкция действий

Прежде всего, для приготовления грунтовой смеси, понадобятся: строительный ПВА, перфоратор с миксером и большая ёмкость из пластика. Все работы должны производиться в тёплом помещении.

Наносить грунтовочную смесь рекомендуется использовать плоские кисти, валик с коротким ворсом и пластиковый контейнер, имеющий ребристые края.

Рекомендация! Не делайте сразу большое количество смеси – можно оставить неиспользованной часть приготовленного объёма, и материал пропадёт (затвердеет)!

Для приготовления смеси, нужно налить клей ПВА в пластиковое ведро и маленькими порциями добавлять в него тёплую воду, осуществляя при этом непрерывное перемешивание до получения однородной (сметанообразной) массы.

Компоненты следует брать в таком соотношении: 1 часть воды на 2 части клея. Можно увеличить прочностные характеристики путём добавления смеси просеянного мелкого мела или гипса.

Когда обработке подлежит бетонный пол, в раствор нужно включить цементную «муку» марки не меньше М400.

Заключительные рекомендации

Следует предостеречь от вероятных неприятностей, с которыми может столкнуться мастер при применении состава:

1. Нельзя наливать слишком толстый слой грунтовки, иначе со временем он может отойти от основания вместе с готовым финишным покрытием.

2. Когда планируется красить пол в светлые тона, нужно максимально истончить слой грунтовки. Через полгода тёмный цвет бетона обязательно проявится в виде тёмных разводов и жёлтых пятен.

Используя материалы статьи, можно нехитрым способом осуществить качественный и недорогой монтаж грунтовки под линолеум, плитку, ламинат, краску или любое другое напольное покрытие.

Хотя, в случаях, когда используются собственноручные смеси, качество материала и итог работы, конечно же, снижаются, чем при аналогичном использовании заводского варианта строительной грунтовки.

        Поделиться:

как самому сделать или приготовить грунт глубокого проникновения для стен рецепт, чем можно заменить

Грунтовка играет очень важную роль во время строительно-монтажных работ. Главной особенностью данного материала является то, что грунт способен улучшить адгезию и защитить поверхность от воздействия самых разных отрицательных факторов. В продаже можно найти огромный выбор материала для разных оснований, которые обладают разными свойствами. Но если хочется сэкономить и при этом получить неплохой результат, то приготовить грунтовку можно самостоятельно.

Что такое грунтовка и ее состав

Специалисты рекомендуют в обязательном порядке использовать грунтовку, чтобы улучшить качество ремонта.

Специалисты рекомендуют в обязательном порядке использовать грунтовку, чтобы улучшить качество ремонта. Также материал применяется для того, чтобы лучше ложилась финишная отделка, в дальнейшем на стенах не образовывалась плесень и грибок, а также не происходило повреждение внешнего покрытия. Составы могут существенно отличаться в зависимости от типа грунта и его назначения.

Какие виды грунтовок существуют

Производители предлагают несколько разных вариантов грунтовки. Чаще всего специалисты во время выбора учитывают состав материала.

Если же человек имеет недостаточное количество опыта в строительстве, то лучше всего учитывать назначение раствора.

Кроме того, отличаться смеси могут добавками, которые предоставляют грунтовке дополнительные характеристики или же усиливают те, которые присутствуют изначально. Дальше рассмотрим наиболее популярные варианты грунтов, которые помогут улучшить результаты проведенного ремонта.

  • По состав различают акриловые, глифталевые, минеральные, кварцевые, алкидные и другие смеси.
  • Если говорить о степени проникновения, то может быть обычный раствор или же смесь глубокого проникновения.
  • Делятся грунты на разные виды в зависимости от того, для обработки какой именно поверхности они будут применяться.
  • Разделить на разные типы растворы можно в зависимости от того, для наружных или для внутренних работ будут использоваться. Также в продаже предлагаются универсальные составы, которые одновременно подходят для нанесения как внутри помещений, так и снаружи.
  • Делятся на разные типы грунты в зависимости от своих свойств – антисептические, противогрибковые, антикоррозийные и прочие.

Если подбирать материал самостоятельно, то обязательно стоит учитывать то, в каком состоянии находится основание и какой вид отделки будет применяться в дальнейшем.

Это позволит подобрать наиболее подходящий вариант смеси, который поможет сделать качественный и долговечный ремонт.

Если же есть необходимость сэкономить или требуется совсем немного состава, то его можно приготовить самостоятельно в домашних условиях. Для этого потребуется минимальное количество простых компонентов и следовать предоставленной ниже инструкции, придерживаясь определенных пропорций.

Изготовление грунтовки своими руками

На приготовление грунтовки своими руками потребуется минимальное количество времени и материалов. При этом очень важно следовать инструкции и соблюдать пропорции, чтобы получить раствор с нужными характеристиками.

Состав для глубокого проникновения

Наиболее простым и популярным вариантом самодельного грунта на сегодняшний день считается смесь глубокого проникновения. Основным компонентом раствора является строительный клей ПВА, который может достаточно глубоко проникать в основание и защищать его от попадания влаги и повреждений. Состав после нанесения и полного высыхания создает тонкую водостойкую пленку, связывает между собой частички пыли и при этом не сказывается отрицательно на вентиляции. Очень важно в данной ситуации правильно соблюдать пропорции. В противном случае пленка от клеевого раствора начнет отслаиваться в дальнейшем вместе с отделочным материалов.

Для приготовления потребуется на литр клея ПВА 8 литров чистой воды и мастерок цемента. Если есть возможность, то цемент можно заменить обычным порошкообразным мелом. Сначала между собой тщательно перемешивают клей и воду. Дальше добавляют цемент и размешивают раствор до однородного состояния. В последнюю очередь самодельную грунтовку необходимо тщательно процедить сквозь марлю, чтобы убрать комочки, которые могли остаться в смеси.

Полученный состав изначально стоит протестировать на каком-то одном участке. После того, как грунт высохнет, не должно появляться пленки. Если она образовалась, то в раствор добавляется еще немного воды. Покрытые смесью стены должны иметь легкий беловатый оттенок.

Укрепляющая

Подобные составы в большинстве случаев используются для проведения ремонта или же реставрации старых помещений. Достаточно часто могут применяться во время утепления. Подобные самодельные грунты нужны для того, чтобы сделать основание более прочным. Особенно часто материал применяется для обработки кирпичных, бетонных или же пористых оснований.

Рецепт приготовления укрепляющей грунтовки достаточно простой. На его приготовление уйдет минимальное количество времени, а полученный результат сможет приятно удивить каждого. Потребуется взять 100 грамм медного купороса, половину литра столярного клея, брусок хозяйственного мыла. Все компоненты можно приобрести в любом специализированном магазине, а их стоимость более, чем приемлемая. Приготовление грунтовки стоит проводить в соответствии со следующими рекомендациями.

Сначала доводятся до кипения 7 литров воды. После того, как вода закипит, огонь стоит сделать как можно меньше. Все время помешивая воду, в него добавляется измельченное на терке мыло. Когда смесь станет однородной, можно добавлять клей, а после этого купорос. Полученный раствор варится на небольшом огне еще полчаса. Если не получилось приготовить грунтовку без комков, то их необходимо тщательно разбить с помощью строительного миксера. Полученный состав после частичного остывания процеживается через несколько слоев марли и оставляется до тех пор, пока он не станет комнатной температуры.

Подобный самодельный состав станет отличным решением в том случае, если потребуется не только укрепить основание, но еще и защитить его в дальнейшем от образования грибка или же плесени.

Смесь для дерева

Дерево обязательно нужно предварительно обрабатывать, чтобы улучшить не только его характеристики, но и увеличить срок эксплуатации. Для приготовления самодельной грунтовки потребуются такие компоненты, как кусок мыла, 30 мл олифы, 200 грамм малярного клея, 2 кг порошкообразного мела, 250 грамм алюмокалиевых квасцов.

Литр воды нужно довести до кипения и смешать с квасцами. Отдельно разогревается на маленьком огне раствор клея, который затем смешивается с мылом.

Смесь должна быть однородной и не содержать комочков. После этого в грунтовку нужно добавить олифу и полученный кварцевый раствор, мел. Для приготовления грунта стоит использовать алюминиевую посуду. После того, как состав полностью высохнет, можно начинать наносить его на заранее тщательно подготовленную поверхность.

В том случае, если раствор получился слишком густым, то стоит добавить немного горячей воды. В противном случае самодельная грунтовка не будет достаточно хорошо и равномерно ложиться на основание. Соответственно, не получиться достичь необходимого результата.

Особенности и способы нанесения

Процесс грунтования достаточно простой и справиться с ним сможет даже тот человек, который никогда не занимался строительными или ремонтными работами.

Для этого достаточно придерживаться некоторых простых правил.
  • Предварительно основание нужно тщательно подготовить. Для этого потребуется убрать старое покрытие, устранить пыль, грязь, краску и другие загрязнения.
  • Наносить самодельный грунт глубокого проникновения стоит с помощью валика или кисти. На одном месте нельзя проводить два раза. Двигаться обязательно нужно сверху вниз, чтобы не образовывались потеки.
  • После того, как первый слой самодельной грунтовки полностью высохнет, можно начинать наносить еще один слой.

Очень важно использовать для обработки оснований только свежие растворы. В противном случае материал может содержать комки или же и вовсе потерять свои свойства. Тогда нанесение подобной грунтовки не будет иметь никакого смысла.

Грунтовками глубокого проникновения легко готовится своими руками в домашних условиях. Для этого не нужно иметь никаких специальных знаний или же навыков. Достаточно следовать предоставленной выше инструкции и соблюдать указанные пропорции, чтобы получить качественный и эффективный раствор.

Чем заменить грунтовку и как приготовить её своими силами

Ни один ремонт не обходится без строительных материалов, которые играют значительную роль. В особенности это касается грунтовки – самой популярной строительной смеси, которая способна улучшить качество штукатурки, лакокрасочного материала и обоев. Её можно приобрести в любом специализированном магазине, но если есть желание, то её можно изготовить своими силами, при этом используя клей ПВА. На рынке строительных материалов можно купить разнообразные компоненты, из которых не сложно изготовить качественный продукт, который по качественным характеристикам ни в чем не уступит магазинному аналогу.

Напрашивается вопрос – зачем изготавливать своими руками грунт, если на рынке строительных материалах представлен обширный выбор специального средства? И чем можно заменить грунтовку?

  •  Изготовлением самостоятельно позволит значительно экономить деньги, за что постоянно клиент переплачивает за упаковочный материал.
  •  Если средство закончилась, а осталось совсем немного, не бежать же покупать сразу в специальный магазин за средством? Причем можно её сделать самому, к тому же домашняя получится не хуже, чем магазинная. Материал в домашних условиях изготавливается быстро. А вот ингредиенты к средству придется закупить заранее. Рассмотрим, чем заменить грунтовку и как приготовить её своими силами?

Необходимые инструменты, чтобы заменить магазинный материал

Самой востребованной строительной смесью является грунт глубокого проникновения. Такая смесь может быть изготовлена из основы клея ПВА для разных поверхностей, обеспечивающей водонепроницаемость основы. Для изготовления средства подходит только строительный клей, и на выходе получится хорошего качества смесь, однако ПВА используется только в качестве добавочного, а не главного компонента.

Элементарные варианты замены грунтовки самостоятельно

Чтобы заменить грунт требуется:

  •  Смешать клей с водой до получения однородной смеси
  •  Высыпать цемент и переместить смесь
  •  Процедить полученные смешанные компоненты через марлевую ткань, а затем нанести на поверхность

Если отсутствует цемент, легко можно заменить на порошковый мел.

Грунтовочное средство должно наноситься на покрытия стен равномерно, при этом чуть-чуть оставлять белый след. Прежде чем наносить приготовленную суспензию на поверхность, важно опробовать на небольшом и чуть заметном участке. Если после сушки стена не стала покрываться пленкой, таким образом пропорции выверены были верно. Если же на поверхности была образована пленка, то лучше всего добавить побольше воды. Приготовление грунта в домашних условиях не только способно проникать в стены, а еще оказывать антисептическое действие не хуже, чем в специализированном магазине.

Укрепление поверхности

Заменить магазинную смесь для укрепления стен можно самостоятельно, если приготовить материал из:

  •  Медного купороса – 1л.
  •  Хозяйственного мыла – 2 кусков
  •  Столярного клея – 5 л.

Грунтовочная масса наносится легко в том случае, даже когда отсутствует опыт у работника. Для качественного нанесения слоя грунтовки требуется выполнять следующие условия:

  •  Перед грунтом требуется хорошо очистить рабочую поверхность от давнего лакокрасочного покрытия, а также многих загрязнений
  •  Перелить смесь в специальную емкость и обработать стены, при этом используя кисть или валик.
  •  Первоначально требуется провести обработку углов, а затем остальные части.

Внимание! После сушки первичного нанесения наносить вторичный слой, что улучшит сцепление и можно будет выполнять другие работы.

Для улучшения сцепления адгезии

Заменить раствор можно другим способом. Чтобы улучшить сцепление (адгезию) существует другой способ. Можно приготовить массу, которая будет способна сцепить металл или глянец. Чтобы заменить средство для самостоятельного изготовления смеси понадобится:

  •  Кусок мыла хозяйственного – 1 кусок
  •  Малярный клей – 200 гр.
  •  Порошок состоящий из квасцев аллюмокалиевых – 250 гр.
  •  Порошок мела – 2 кг.
  •  Чистая олифа – 30 миллилитров

Чтобы заменить грунт рассмотрим способ приготовления.

  •  Разводится в одном литре кипяченой воды в квасцы.
  •  Затем развести 10% клея малярного.
  •  Поставить клей на огонь, и в результате закипания требуется перемешать, чтобы масса не содержала комочки. Затем добавляется олифа и квасцы.
  •  Нужно просеять мел, а комочки размешать и разбить. Раствор должен быть не очень густым и не слишком жидким. При добавлении в воду, требуется быть внимательным.

Раствор по этому способу не процеживают, его остывают, и он готов к применению. Если раствор не использовать в течение суток, он может быть не пригодным для дальнейшего применения.

Компоненты для глубочайшего проникновения

Для использования раствора нужно взять:

  •  Емкость с водой в количестве 8 литров
  •  Клей ПВА в количестве 1 литра.
  •  Цемент — 1 мастерок.
  •  В Емкость добавить клей, затем наполнить водой и все компоненты между собой смешать, чтобы образовалась кашица однородной основы.
  •  Добавить цемент или мел
  •  Получившуюся массу процедить через марлю

Советы по приготовлению грунтовочного раствора

При правильном смешивании ПВА планка, которая образуется в результате высыхания не должна быть приметной. Если добавляется клей в емкость с водой в значительном количестве, то грунт превращается в гибкий пленочный слой, который в дальнейшем будет отслаиваться от покрытия стен. В том случае, если его будет больше количества, то масса отстает от основы скорее. Бывает, что в средстве, в которой присутствует превышение ПВА, не происходит отслоение, но после определенного периода клей желтеет и тогда внешний вид будет непривлекательным.

Внимание! Домашнюю грунтовку использовать в течение суток, иначе она может утратить свои свойства

расход на 1 м2, бетоноконтакт адгезионный, акриловая, от плесени и грибка и др виды, как сделать своими руками и правильно наносить

Качество ремонта во многом зависит от того, насколько точно были соблюдены правила проведения отделочных работ. Не менее важным в этом вопросе являются разновидности применяемых материалов, а именно их сочетаемость, техника и последовательность нанесения. В рамках этой статьи рассмотрим виды грунтовок для стен, их особенности и назначение.

На фото один из способов нанесения грунтовочного состава

Что это такое

Грунтовка — это специальный раствор для обработки стен, который улучшает свойства основания и подготавливает его к какому-либо виду отделки.

Назначение грунтовок:

  •  Устранение мелких дефектов стен, пола, потолка и улучшение адгезии этих поверхностей с иными видами отделочных материалов (краска, штукатурка, клей).
  • Антибактериальная и противогрибковая защита. Появление грибка и плесени неизбежно в помещениях с высокой влажностью.
  • Уменьшение водопоглощения, либо полная гидрофобизация.
  • Выравнивание цвета стен.
  • Укрепление поверхности, уменьшение расхода отделочных материалов (штукатурки, краски).

Растворы для грунтования имеют разный состав в зависимости от назначения: латекс, жидкое стекло, различные битумы, кварцевый наполнитель и прочее.

Какие виды бывают

Выбирают грунтовку, исходя из материала основания (стены), назначения и вида последующей отделки. Рассмотрим все виды подробнее.

Акриловая глубокого проникновения

Белый полупрозрачный глубокопроникающий раствор не имеет неприятного запаха и быстро сохнет.

Один из часто применяемый вид грунтовок для стен. Проникающий универсальный состав на акриловой основе обеспыливает поверхность, укрепляет старые и рыхлые штукатурки, улучшает адгезию, немного снижает водопоглощение стен и потолков и тем самым не дает влаге уйти из наносимых штукатурок.

Расход во многом зависит от пористости стен, в среднем 100-200 г на квадратный метр.

Состав: вода и акриловые полимеры.  Также могут присутствовать антибактериальные и противогрибковые компоненты. Важно обращать внимание на количество сухого остатка в составе акрилового раствора. В хороших грунтовках для стен это значение должно быть на менее 10%, в материалах для пола — 15%.

Сохнет раствор за 2,5-3 часа.

На заметку. Акриловая грунтовка часто используется при декоративной штукатурке в качестве и в составе .

Производители: Ceresit CT 17, Unis, Старатели, Оптимист, Боларс, Лакра и др.

Адгезионный кварц-грунт типа «бетоноконтакт»

Бетон-контакт значительно улучшает сцепление стены и отделочных материалов. Краситель в составе грунтовки помогает контролировать равномерность нанесения.

Бетоноконтакт — это отличный вариант, чтобы улучшить адгезию бетона и любых листовых материалов: гипсокартона, ДВП, ДСП, ОСБ-плит перед нанесением или д.

Состав грунтовки: акриловая дисперсия (более концентрированная, чем в универсальной), кварцевый песок, красители.

После высыхания бетоноконтакта стена или потолок становятся шероховатыми из-за нанесенного песка. Благодаря этому даже гладкие поверхности, в том числе , можно оштукатуривать или отделывать керамической плиткой.

Расход: 200-300 г на 1м2 при нанесении валиком.

Производители: Ceresit CT 19, Alpina Expert Кварц-грунт, KNAUF Бетоконтакт, Farbe, Текс и др.

Грунтовка против плесени и грибка

Грунт-антиплесень

Служит для противогрибковой и антибактериальной защиты дерева, а также для обработки стен во влажных помещениях и подвалах.

Антигрибковые грунтовки изготавливают на основе универсальных акриловых с добавлением антисептика. Поэтому они обладают такими же техническими характеристиками: расходом и временем высыхания.

Примеры производителей: Alpina Expert Bio-Stop, ECOTERRA, Gunstig, Лакра, Ареал и др.

Алкидная (глифтеновая)

Алкидный грунт

Используется в основном для защиты металла от ржавчины, дерева от гниения. Также ГФ-грунт применяют  на поверхности из пластика, ДСП, ДВП, стекла или стекловолокна как промежуточный слой перед окрашиванием.

Наносят алкидные составы любым удобным способом — валиком, кистью, распылителем. Допускается разбавление раствора уайт-спиритом.

Расход: 100 гр/м2.  Время высыхания — 24 часа.

Важно! Этот вид грунтовочных материалов токсичный и пожароопасный. Используйте при работе респиратор, перчатки, проветривайте помещение.

Примеры производителей: Otex, Лакра, Текс ГФ-021, TURY.

Силикатная

В основе этого материала жидкое калийное стекло. Грунтовку применяют при внутренней отделке и фасадных работах для укрепления поверхности, защиты от агрессивной среды и атмосферных осадков, подготовке к окрашиванию силикатными красками.

Подходит для обработки силикатного кирпича, бетона, цементно-песчаной и известковой штукатурки.

Расход при нанесении в один слой составляет 200-250 гр на м2.

Производители: Caparol Sylitol-Minera, Derufa Силикатгрунт, Ceresit CT 15.

Какую грунтовку выбрать (видео обзор)

В этом видео мастер рассказывает о видах грунтовки и их назначении, а также о важности обращать внимание на состав (сухой остаток латекса).

Подготовка стен перед грунтованием

Несколько правил подготовки стен:

  • Поверхности должны быть сухие и чистые, без масляных пятен и осыпающихся участков.
  • Если выравнивались штукатуркой, то должны полностью высохнуть перед грунтованием.
  • Старую отделку (обои, краску, побелку) лучше удалить/зачистить.
  • Стены нужно обеспылить щеткой, пылесосом или влажной тряпкой.

Техника нанесения и расход на 1 м2

Наносить грунтовку на стены можно с помощью широкой малярной кисти или валика. Валиком довольно быстро и равномерно можно обработать всю площадь. При подготовке потолка опять же лучше выбрать валик (поролоновый или меховой) на длинной рукояти. Кистью удобно работать в углах комнаты и труднодоступных местах, а также, когда нужно обильно пропитать поверхность грунтовочным раствором.

Распылитель

Пульверизатор/распылитель/краскопульт ускоряет грунтование и дает равномерный слой. Для дома можно использовать ручной садовый распрыскиватель, а для профессиональной работы — оборудование с компрессором.

В бачок распылителя наливают проникающую грунтовку и равномерно опрыскивают всю рабочую поверхность. Для бетоноконтакта этот способ не подойдет, т.к. грунтовку придется сильно разбавить, а это приведет к оседанию песка. Адгезионный кварц-грунт лучше наносить вручную.


В зависимости от прочности и пористости основания выбирают, какой объем грунтовочного раствора нанести на стены. Например, известковые штукатурки требуется глубоко пропитать, потому что они имеют невысокую прочность. В тоже время, пористый газобетон не нужно пропитывать, а достаточно создать на его поверхности пленку, препятствующую впитыванию влаги из других отделочных материалов.

Ниже рассмотрим, какие материалы и когда нужно грунтовать.

Кирпич Перед оштукатуриванием обильно смочить водой, грунтовка нужна, если требуется связать частички пыли.
Газобетон и др. ячеистые блоки Для снижения водопоглощения перед оштукатуриванием загрунтовать проникающим грунтом с сухим остатком 7-10% в два слоя. Хорошо подойдут силикатные составы.
Бетон Для увеличения адгезии к гипсовым штукатуркам бетонные стены обрабатывают кварц-грунтом (бетоноконтакт). На бетонные полы перед заливкой ровнителей наносят акриловый состав с сухим остатком 12-15%.
Штукатурка Гипсовая и Известковая Они хорошо вытягивают влагу в себя, поэтому обязательно нужно снизить их водопоглащение, загрунтовав глубокопроникающим составом перед следующим слоем штукатурки, поклейкой обоев или жидких обоев.
Штукатурка Цементно-песчаная, плиточный клей Перед поклейкой плитки смочить водой, перед шпаклеванием покрыть универсальной грунтовкой.
Гипсокартон Обрабатывают бетоноконтактом для увеличения адгезии перед поклейкой плитки. Под обои достаточно грунтовки глубокого проникновения.
ДВП, ДСП Грунтуют бетон-контактом, кварцевый песок в составе повысит сцепление с последующе отделкой.
Дерево Защищают от плесени, противогрибковой пропиткой или алкидной крской-грунтом.
Металл Для предотвращения ржавчины металл покрывают алкидной (глифтеновой) грунтовкой типа ГФ-021.

После правильного грунтования газобетона его водопоглощение снижается на 50-70%

Расход грунтующего материала на 1 м2 стены:

Тип Расход, гр на кв.м.
Бетоноконтакт 200-400
Глубокого проникновения 100-180
Силикатная 150-200
Алкидная 100-120
Перхлорвиниловая 60-100

Зная эти цифры и площадь стен можно рассчитать количество грунта без калькулятора.

Ниже на видео показан процесс нанесения грунта из распылителя на кирпичные стены.

Как сделать грунтовку своими руками

Часто при оклейке обоями грунтовку вообще не используют, а если и вспоминают про нее, то не покупают, а готовят в домашних условиях, например, из клея ПВА.

Мнение эксперта

Сергей Шабловский

Штукатур

Я рекомендую самостоятельно разводить грунтовочные составы только из профессиональных материалов, таких как концентрированный акриловый раствор. Это будет дешевле, чем покупать универсальную грунтовку, и надежнее, чем «дедовские» способы.

Из грунта-концентрата

Чтобы быть уверенным в качестве используемого материала, а главное, в соблюдении технологии работ, нужно знать, сколько полимера содержится в грунтовке.

Мнение эксперта

Сергей Шабловский

Штукатур

Как уже говорил выше, сухой остаток акрила/латекса в растворе должен быть не менее 7-10% для глубокой обработки стен и потолка, и 12-15% для грунтования пола перед заливкой выравнивающих самонивелирующихся смесей. Но производители универсальных грунтовок почти всегда скрывают эту информацию, т.е. продают материал сильно разбавленный.

Из концентрированной легко самому сделать грунтовку глубокого проникновения

Выход их этой ситуации простой — приготовить грунт своими руками из концентрата. Например, раствор марки Weber MD 16 имеет в сухом остатке 50% акрила. Разбавляя его водой, можно быть уверенным в качестве получаемого продукта.

Пропорции 50%-концентрат — вода:

  • для обработки пола под ровнители — 1:3;
  • для стен и потолков перед штукатуркой, покраской, оклейкой обоями — 1:5.

Из ПВА клея

Пожалуй, это самый известный рецепт самодельной грунтовки для стен. Её используют и , и под плитку.

Рецепт:

  • Клей ПВА строительный — 1 часть.
  • Вода — 10 частей.
  • Цемент — 1 часть, добавляется в раствор, если будет грунтование под кафельную плитку.

Все компоненты перемешивают в ведре, наносят на стену, обильно пропитывая, но не оставляя подтеков, иначе образуется пленка.

Из обойного клея

Перед поклейкой обоев стены нужно подготовить, но если нет грунтовки, ее можно заменить обойным клеем. Готовят слабый раствор следующим образом.

Пачку любого сухого клея (250 гр) разводят в 6 литрах холодной воды. Перемешивают с помощью миксера, оставляют набухать на 5 минут.

Клеевую грунтовку наносят меховым валиком или малярной кистью по всей поверхности стены. После высыхания (через 4 часа) можно клеить обои.

Расход составить 200 гр/м2.


Надеемся, что статья была вам полезна. Свои вопросы и отзывы оставляйте в комментариях ниже.

Предыдущая

Черновая отделкаКак выполняют оштукатуривание по СНиП: допуски и требования к простой, улучшенной и высококачественной штукатурке

Следующая

Черновая отделкаМеханизированная штукатурка. Это быстро, но не всегда дорого!

Как самостоятельно изготовть грунтовку?. Статьи компании «ООО «Силоксан»»

Прежде всего необходимо определиться какую грунтовку  Вы хотите изготовить: грунтовку глубокого проникновения, гидроизолирующую грунтовку, грунтовку общестроительного назначения? Определились? Тогда начнём!

Изготовление грунтовки глубокого проникновения:

Для грунтовки глубокого проникновения идеально подходит дисперсия Ucar Latex DC640 ― размер частиц этой дисперсии в 2 раза меньше, чем у дисперсий, которые идут для изготовления обычных грунтовок. Продукт содержит 40% основного вещества. Для изготовления грунтовки глубокого проникновения Ucar Latex DC640 достаточно разбавить водой в 3-4 раза. При разбавлении продукт обычно сильно пенится, поэтому в промышленных условиях, когда нет времени жать пока пена осядет и требуется интенсификация производства добавляют пеногаситель. Добавляют или силиконовый пеногаситель, например Xiameter AFE-0310 Antifoam Emulsion или масляный пеногаситель, например, D-11. Пеногаситель обычно добавляют в количестве 100-1000 гр/тонну грунтовки предварительно разбавляя (для повышения эффективности пеногашения). Обратите внимание, что силиконовых пеногасителей необходимо добавлять меньше, примерно в 3 раза, чем масляных. В случае, если изготавливается небольшое количество грунтовки ― то можно обойтись и без пеногасителя.   Если планируется готовую грунтовку хранить длительное время, например с целью дальнейшей реализации, то необходимо добавить биоцид/консервант, например, Dowicil 75 в количестве 1 кг на 1 тонну готовой грунтовки. Если грунтовка будет использоваться сразу после изготовления или храниться непродолжительное время ― можно обойтись без биоцида. 

Порядок ввода компонентов такой:

1. Отмеряют нужное количество воды и дисперсии. Для изготовления 100 кг грунтовки потребуется 75-80 кг воды.

2. В отдельной ёмкости подготавливают раствор биоцида (растворяют в небольшом количестве воды). Для изготовления 100 кг грунтовки Вам понадобится 100 грамм биоцида Dowicil 75.

3. Добавляют подготовленный раствор биоцида к общему количеству воды.

4. Добавляют пеногаситель (предварительно разбавленный в 5 раз. ПРИ РАЗБАВЛЕНИИ ВОДУ ДОБАВЛЯЮТ В ПЕНОГАСИТЕЛЬ!!!). На 100 кг грунтовки потребуется примерно 30 грамм пеногасителя Xiameter AFE-0310 Antifoam Emulsion.

5. К отмерянному количеству воды добавляют Ucar Latex DC640. На 100 кг грунтовки потребуется 20-25 кг дисперсии.

6. Перемешивают при небольшой скорости мешалки.

7. Фасуют.

Видеоурок: «Как сделать грунтовку глубокого проникновения?» от замечательного мастера Романа Одарченко:

Больше видеоуроков на канале Redecoration!!!

Однако суровые реалии строительного рынка таковы, что 70% продаваемых грунтовок являются обычными общестроительными грунтовками. Дело в том, что дисперсии, которые идут для обычных грунтовок дешевле, т.е. заработать на них можно больше, а неискушенный  потребитель разницы всё-равно не заметит. А поэтому:

Изготовление общестроительных грунтовок:

Для изготовления грунтовок общестроительного назначения  используют латексную дисперсию Ucar Latex DL420  (50% основного вещества) путём её разбавления до концентрации 6-8% (в 5-7 раз). Порядок ввода компонентов такой же, как и в случае грунтовки глубокого проникновения, но дополнительно нужно добавить Dowanol DPnB (1-2% от массы латекса). Его добавляют для понижения температуры плёнкообразования. Если грунтовка используется в тёплую пору года ― Dowanol DPnB нужно добавлять меньше, если в холодную ― больше.

Изготовление стабилизирующих грунтовок:

Для стабилизации меловых или хрупких поверхностей используют дисперсию Ucar Latex XZ91930. Для этих целей её следует развести 1:1. Разведённую грунтовку наносят кистью или распылением. Низкая минимальная температура пленкообразования дисперсии Ucar Latex XZ91930  позволяет достичь правильного плёнкообразования в обычных практических условиях. Для улучшения функциональных способностей необходимо добавить небольшое количество коалесцента. Ориентировочная рецептура приведена ниже:

Изготовление влагоизоляционных грунтовок:

Для изготовления грунтовок общестроительного назначения  используют латексную дисперсию Ucar Latex DL420  (50% основного вещества) или Ucar Latex XZ91930 ― для влагоизоляционных грунтовок (50% основного вещества) путём их разбавления до концентрации 6-8%. Порядок ввода компонентов такой же, как и в случае грунтовки глубокого проникновения, но дополнительно нужно добавить Dowanol DPnB (1-2% от массы латекса). Его добавляют для понижения температуры плёнкообразования. Если грунтовка используется в тёплую пору года ― Dowanol DPnB нужно добавлять меньше, если в холодную ― больше.

Если у Вас возникли вопросы, понадобились образцы продукции или Вы хотите купить опытную партию для начала производства ― обращайтесь:
+38 050 3127173
[email protected]

Владимир

Как сделать грунтовку


способы приготовления в домашних условиях

Чтобы отделочный слой краски или штукатурки продержался на стене как можно дольше, перед началом отделочных работ стену рекомендуется покрывать слоем грунтовки. В строительных супермаркетах на сегодняшний день в продаже находится большое количество различных видов грунтовки от разных производителей. Однако не все знают, как сделать грунтовку своими руками, себестоимость которой будет на порядок ниже, чем у готовой.

Вернуться к содержанию

Польза от грунтовки

Как было отмечено выше, грунтовка увеличивает срок службы настенного покрытия, улучшая качество сцепления материала с поверхностью стены. Грунтовка представляет собой жидкую смесь, которая наносится на стены равномерным слоем и по мере высыхания создает плотную пленку, на которую хорошо ложится штукатурка, краска, обои и пр. Если с ваших стен сыпется штукатурка, а стены сами по себе рыхлые и ветхие, штукатурка поможет дополнительно их укрепить.

Исходя из того, какие функции должна будет выполнять грунтовка, ее можно разделить на следующие виды:

  • Грунтовка для повышения качества сцепления наносимого материала с поверхностью стены;
  • Грунтовка для укрепления стен;
  • Грунтовка глубокого проникновения с водоотталкивающим и защитным воздействием.

Кроме того, грунтовка обладает антикоррозийными и антисептическими свойствами. В некоторых составах использование дополнительных ингредиентов придает ей кроме прочего огнеупорность.

Следует знать, что обработка рабочей поверхности грунтовкой требуется практически при любых отделочных работах, например при штукатурке пенобетонных и газобетонных стен и покрасочных работах, таких как покраска бетонных полов или шифера.

Перед тем, как приготовить грунтовку в домашних условиях, определитесь с тем, какие функции она должна будет выполнять, так как именно от этого будет зависеть ее состав.

Вернуться к содержанию

Как самому сделать грунтовку?

Вопрос о том, как сделать грунтовку для стен своими руками, на сегодняшний день волнует многих. Казалось бы, чего проще отправиться в ближайший строительный магазин и приобрести уже готовый раствор? Однако присмотревшись повнимательнее к ценам, вы поймете, что разница есть, при чем весьма ощутимая. Грунтовка состоит из достаточно простых и недорогих компонентов. Самое важное – это правильно подобрать состав и рассчитать количество каждого компонента.

Вернуться к содержанию

Как сделать грунтовку для стен, повышающую их прочность?

Чтобы приготовить упрочняющий состав, необходимо взять:

  • 1 часть медного купороса;
  • 5 частей костного столярного клея;
  • 2 части 60-процентного хозяйственного мыла;
  • Эмалированное ведро или кастрюлю подходящего размера. Лучше всего, если эта посуда будет ненужной в дальнейшем, так как для приготовления еды ее впоследствии использовать будет уже нельзя.

Медный купорос

Пошаговая инструкция, как сделать грунтовку для стен:

  1. В емкость наберите холодной воды и доведите ее до кипения.
  2. Хозяйственное мыло предварительно измельчите или натрите на обычной кухонной терке – так вам не придется долго ждать, пока оно полностью раствориться.
  3. Высыпьте полученную мыльную крошку в кастрюлю, уменьшите огонь до минимального, и несколько минут размешивайте мыло в воде при помощи деревянной лопатки или палки, пока мыло полностью не раствориться.
  4. Добавьте в получившийся раствор медный купорос и столярный клей.
  5. Накройте емкость крышкой и оставьте вариться на медленном огне приблизительно на полчаса. Смесь необходимо периодически помешивать, чтобы не допустить образования комочков.
  6. Через полчаса раствор необходимо снять с огня, немного остудить и процедить еще горячим через сито или несколько слоев марли.
  7. Когда раствор полностью остынет, его можно начинать наносить на стены.

Полезно знать! Если в процессе варки вы упустили момент и в растворе все же появились комочки, от них можно будет избавиться при помощи обычного миксера или погружного блендера. Однако будьте осторожны, чтобы не допустить поломки техники. Сразу после того, как вы вытащите миксер из раствора, его необходимо будет тщательно промыть.

Вернуться к содержанию

Как сделать грунтовку глубокого проникновения своими руками?

Для максимальной защиты стен от неблагоприятных условий окружающей среды, используют грунтовку глубокого проникновения, которую чаще всего изготавливают на основе клея ПВА.

Для приготовления штукатурки нам потребуется строительный клей ПВА, который как нельзя лучше справится с задачей повышения прочности стен и их водонепроницаемости. Казалось бы, при столь полезных свойствах строительного клея ПВА им с легкостью можно было бы заменить саму грунтовку. Однако делать этого категорически нельзя. Клей ПВА образует на поверхности влагонепроницаемую пленку, которая со временем может отслоиться вместе со слоем штукатурки. Кроме того, еще со школы вы наверняка помните, что клей ПВА имеет свойство желтеть со временем, что негативно скажется на внешнем виде отделки, в особенности на обоях. Поэтому клей ПВА должен использоваться не как основной компонент, а лишь в качестве добавки.

Вернуться к содержанию

Как сделать грунтовку из клея ПВА?

Сделать грунтовку из клея ПВА очень просто. Для этого потребуется взять:

  • 1 часть строительного клея ПВА;
  • 8 частей воды;
  • Немного цемента.

Все что необходимо будет сделать, это смешать клей с водой, добавить в смесь цемент, хорошенько все перемешать, а затем процедить через сито или марлю. Преимуществом данного способа приготовления грунтовки является его простота и удобство, а также отсутствие необходимости затрачивать время на то, чтобы вначале довести смесь до кипения, затем сварить, а потом еще и дождаться, пока смесь остынет. Грунтовка на основе ПВХ будет готова к употреблению сразу после того, как вы процедите раствор. Единственный ее минус заключается в том, что храниться она может не более суток, так что запастись самодельной грунтовкой на основе ПВА впрок не получится.

Грунтовка из ПВА своими руками

Существует небольшая хитрость, как можно определить, правильную ли пропорцию клея, воды и цемента вы использовали. Перед тем, как приступить непосредственно к обработке грунтовкой стен, нанесите самодельный раствор на небольшой участок и дайте ему высохнуть. Если в результате на поверхности данного участка не образовалась плотная пленка, значит пропорции были взяты верно и можно приступать к грунтовке.

Вернуться к содержанию

Как самому приготовить грунтовку по дереву?

Среди прочих материалов обработка дерева является, пожалуй, одной из наиболее сложных задач. В первую очередь необходимо разобраться, в каких случаях дерево вообще необходимо грунтовать, а в каких достаточно будет лишь покрыть поверхность специальной пропиткой.

Грунтовать дерево нужно, если:

  • Деревянная поверхность является частью наружного фасада здания или соприкасается с наружными стенами;
  • Если на деревянной поверхности присутствую дефекты, которые нельзя удалить без использования шпаклевки и скрыть без дальнейшего окрашивания;
  • Если деревянная поверхность расположена в сыром и неотапливаемом помещении;
  • Если дерево планируется в дальнейшем покрыть слоем лака или краски.

Для дополнительной защиты деревянных поверхностей используются, как правило, алкидные, акриловые, антисептические и шеллаковые грунтовки, браться за изготовление которых самостоятельно весьма рискованно. Дерево – капризный материал, и экспериментируя на нем с различными грунтовками, вы рискуете его сильно повредить. Поэтому в данном случае лучше приобрести готовую грунтовку.

Вернуться к содержанию

Как сделать грунтовку под обои?

Некоторым умельцам получается хорошо сэкономить и облегчить себе жизнь, объединив обойный клей и грунтовку в одном растворе. В таком случае обойный клей выступает альтернативой клея ПВА, так как имеет схожие физические свойства и глубину проникновения. Еще одним преимуществом замены клея ПВА на обойный является то, что вам не придется ждать, пока грунтовка высохнет. Вы обрабатываете участок стены обойным клеем и тут же прикладываете к нему лист обоев необходимого размера.

Нанесение грунтовки валиком

В завершении несколько слов о том, как необходимо наносить грунтовку.

  1. Прежде чем приступать к процессу грунтовки, предварительно необходимо подготовить поверхность: удалить с нее остатки прежнего покрытия, пыль и прочий мусор.
  2. Грунтовку удобнее всего наносить при помощи валика, окуная его в специальную пластиковую ванночку, которая благодаря наличию особой ребристой поверхности не даст валику впитать лишний раствор. Углы и прочие труднодоступные места удобнее обрабатывать при помощи кисти.
  3. Специалисты рекомендуют наносить грунтовку одним размашистым движением руки снизу вверх. Нужно стараться нанести ее таким образом, чтобы валик два раза не проходил по одному и тому же месту, иначе слой грунтовки будет неравномерным. Чтобы сделать слой более плотным, дайте первому слою полностью высохнуть, и только после этого наносите поверх него второй и последующие слои.

Полезно? Сохраните себе на стену! Спасибо за лайк!

Primer Design

Существует два основных типа праймеров, которые используют люди:

  1. Те, которые усиливают ДНК
  2. Те, которые модифицируют ДНК

Мы сосредоточимся на первом. Мы будем использовать белок ApoE в качестве модели. Мутации в нем являются сильным генетическим маркером болезни Альцгеймера. Мутации в этом гене происходят в аминокислотах 112 и 158. Наша цель — амплифицировать этот ген и отправить его для секвенирования.Сначала мы создадим праймеры для всего гена, а затем только для важного региона.

Сначала найдите последовательность гена, который вы хотите амплифицировать или модифицировать. Отличное место для поиска — NCBI (http://www.ncbi.nlm.nih.gov/). Я искал и нашел последовательность гена мРНК ApoE человека (http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1). Существует около 3,2 миллиарда оснований ДНК в людях, поэтому наши праймеры, вероятно, должны быть по крайней мере такими сложными. Поскольку в ДНК 4 основания, сложность равна 4 степени длины.ДНК из 16 пар оснований будет встречаться примерно 1 раз в 4,3 миллиарда раз (416). Обычно праймеры имеют длину от 15 до 21 пары оснований.

Сначала нам нужно понять, как копируется ДНК. ДНК амплифицируется от 3 ’(произносится как« три основных ») до 5 ′ (произносится как пять основных) конца копируемой цепи. Говорят, что усиление идет в направлении от 5 ’до 3’.

Прямой праймер прост и представляет собой праймер, который находится на нижней нити со стороны 3 ‘.Обратный праймер является более сложным и связывается с верхней цепью на 3 ’стороне.

Давайте сначала сделаем пример

Вот наша ДНК:

5 ’- ATGAGGTTTGCAGCG — 3’

| | | | | | | | | | | | | | |

3 ’- TACTCCAAACGTCGC — 5’

Давайте сделаем гипотетические праймеры для коротких кусочков ДНК по 4 основания в каждом.

Передние праймеры должны связываться с 3′-концом нижней нити и поэтому идентичны верхней нити! Это означает, что наш гипотетический прямой праймер будет ATGA.Поскольку праймеры читаются и создаются людьми, наш обратный праймер должен быть написан от начала до конца. Это называется «обратным дополнением» верхней нити. 4 основания, которые связаны с 3 ‘верхней цепи, — это TCGC. Но помните, что праймер начинается с 3’-конца, поэтому его следует читать как CGCT. Это обратное дополнение, обратное противоположности верхней нити.

Глядя на последовательность ApoE, попробуйте сделать 20 базовых прямого и обратного праймеров.Ответы ниже. http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1

ApoE forward Primer: cagcggatccttgatgctgc

ApoE обратный праймер: aagcaccaagttcagggtgt

Мы можем использовать эти праймеры для амплификации ДНК, выделенной из вас.Очистите это и отправьте это для последовательности. Но … секвенирование показывает, что даже хорошие из них имеют длину всего около 1000 оснований, а ген> 7000 оснований.

Праймеры не нужно создавать только в конце ДНК, вы можете создать их где угодно, чтобы усилить ДНК. Теперь давайте увеличим область от 112 до 158, чтобы мы могли иметь более разумную последовательность.

Сначала давайте переведем ДНК, чтобы узнать, где эти аминокислоты находятся в ДНК, используя http: // web.expasy.org/translate/ Выберите «Включить последовательность нуклеотидов». Теперь давайте найдем строку аминокислот, найденную в переводе на странице NCBI «VCG». Из-за пробелов в веб-странице перевода нам нужно найти на странице «V C G». Это должно быть в 5 ’Frame 2.

Основания в праймере не отображаются в последовательности, и обычно первые несколько оснований зашумлены, поэтому давайте создадим праймер, который находится примерно в 50-100 основаниях выше по течению от VCG.

Я выбрал в качестве своего прямого праймера: gagacgcgggcacggctgtc

Обратный праймер должен находиться на расстоянии 50-100 оснований ниже R158.Итак, давайте найдем ДНК, которая связана с последовательностью VRL, которая представляет собой аминокислоты 157-159. Я выбрал эту последовательность: agcgcctggcagtgtaccag

, но это не учебник, нам нужно сделать обратное дополнение.

Дополнение: tcgcggaccgtcacatggtc

Обратное дополнение: ctggtacactgccaggcgct

Прямой и обратный праймеры для амплификации белка ApoE, чтобы увидеть, есть ли у нас мутации, которые являются предиктором болезни Альцгеймера:

Вперед: gagacgcgggcacggctgtc

Реверс: ctggtacactgccaggcgct

Наконец, вы хотите выполнить поиск праймеров в геноме человека, чтобы убедиться, что последовательность не продублирована в другом месте (http: // blast.ncbi.nlm.nih.gov/Blast.cgi)

  • Использовать один праймер за раз
  • Выберите Геном человека + Стенограмма для базы данных
  • Click BLAST

Похоже, самая близкая идентичность — 75%, что довольно плохо, но не ужасно.

Можно заказать праймеры в IDT: http://www.idtdna.com/site

, Как правильно наносить макияж? Пошаговое руководство с фотографиями

Если вы потратили много времени на то, чтобы сделать макияж для той ночи с девушками, но только через несколько часов вы обнаружили, что она испачкалась и испачкалась, вы делаете ошибку не использовать грунтовку. Неважно, насколько роскошна твоя основа и другая косметика, без грунтовки ничего хорошего нет. И если есть один продукт для макияжа, который каждый визажист предлагает использовать, чтобы помочь вашему макияжу оставаться на месте, этот волшебный продукт называется грунтовкой. Если вы новичок в макияже, давайте начнем с основ и узнаем, как правильно наносить макияж.

Что такое праймер для макияжа?

Что такое праймер для лица? Грунтовка помогает создать дополнительный слой между вашей кожей и макияжем. Когда вы тратите свое время и силы на то, чтобы сделать макияж, важно сохранить его застрахованным, и, друзья мои, это страховка. Если вы хотите сгладить поверхность вашей кожи, выровнять ее тон или покрыть большие поры и тонкие линии, грунтовка позаботится обо всех этих работах для вас.

Действительно ли учебник для начинающих действительно важен?

ДА! Если вы видели праймеры на счетчиках косметики, но никогда не думали, что этот дополнительный шаг имеет какое-то значение, подумайте еще раз.Вы действительно нуждаетесь в дополнительных затратах на грунтовку, и добавление этого крошечного шага к вашей рутине макияжа делает мир другим. Вы никогда не поймете это полностью, пока не попробуете (я был скептиком начинающего, но как только я сделал это, я не думаю, что смогу обойтись без него. Когда-либо.) Что меня привлекло, так это то, что сочетает в себе преимущества как косметики, так и ухода за кожей. Это действительно так, и моя кожа никогда не выглядела и не чувствовала себя здоровее. Вы можете спросить, как? Ответ заключается в его ингредиентах. Независимо от того, с какой кожей вы сталкиваетесь, для вас найдется учебник для начинающих, и он помогает лечить их, сохраняя ваш образ вместе.

[Чтение: Топ 15 праймеров для макияжа (основы) ]

Как наносить праймер для макияжа?

Если вы хотите включить праймер для макияжа в свою процедуру макияжа, я расскажу вам, как использовать праймер для лица, чтобы максимально использовать его. Но перед этим, вот несколько отличных праймеров, которые вы можете попробовать —

Benefit POREfessional Face Primer, праймер Smashbox Photo Finish, Maybelline Baby Skin Instant Instant Eraser, e.l.f Cosmetics Blemish Control Primer.

Как наносить праймер — пошаговое руководство с рисунками

Следуйте этим простым шагам, чтобы узнать, как наносить праймер и помочь вашему макияжу продержаться целый день.

Что вам нужно
  1. Грунтовка
  2. Чистые кончики пальцев
1. Подготовьте свою кожу

Этот шаг очень важен, если вы хотите, чтобы ваш макияж выглядел безупречно. Используйте мягкое моющее средство, чтобы вымыть лицо, отшелушить и нанести легкий увлажняющий крем прежде всего.Пусть он впитается в вашу кожу.

2. Нанесение грунтовки

Как наносить грунтовку для основания Выравнивайте небольшое количество грунтовки на тыльной стороне ладони и просто наносите ее кончиками пальцев, растирая от носа наружу. Как только она полностью смешается, ваша кожа будет выглядеть более ровной и сияющей, а ваша основа будет сидеть лучше. Подождите несколько минут после нанесения, прежде чем приступить к работе с фундаментом, чтобы грунт погрузился и создал гладкую поверхность.Вы также можете использовать учебник самостоятельно без каких-либо оснований, если хотите сохранить его простоту.

Так будет выглядеть ваша кожа после нанесения. Вы увидите, что появление ваших пор и тонких линий заметно уменьшилось. Кроме того, это помогает справиться с покраснением и сгладить текстуру вашей кожи.

[Чтение: Как применять Foundation Perfectly ]

Советы: максимально использовать свой учебник

Если вы зашли так далеко, я уверен, что вы действительно хотите попробовать учебник для начинающих сейчас.Вот несколько советов и приемов, которые пригодятся вам, когда вы будете применять свой учебник для начинающих.

  • Что касается учебника для начинающих, то меньше значит больше. Достаточно небольшого капли размером с изюм. Втирайте это в кожу хорошо для равномерного покрытия.
  • Всегда наносите увлажняющий крем ПРЕЖДЕ ЧЕМ наносить грунтовку.
  • Если ваша кожа тусклая, попробуйте тонированную грунтовку, которая поможет вернуть коже блеск и жизнь.
  • Всегда убедитесь, что ваш грунт совместим с вашим фундаментом. Вы хотите использовать грунтовки на водной основе на водной основе и грунтовки на силиконовой основе на тех же основаниях.Это предотвратит разделение вашей базы.
  • Нанесите грунтовку вокруг глаз, а также на веки. Это помогает предотвратить смазывание или сминание макияжа, впитывая масла. Это также смягчает гусиные лапки.

Как выбрать грунтовку для моего типа кожи?

Убедитесь, что вы понимаете свой тип кожи, прежде чем отправиться покупать грунтовку, потому что вы не хотите выбирать ту, которая подходит для вашей кожи. Вот как вы можете это сделать.

  • Если у вас сухая или шелушащаяся кожа, выберите увлажняющий грунт.Ищите такие слова, как «успокаивающий», «увлажняющий» и «пополняющий».
  • Если ваша кожа жирная, используйте матирующую грунтовку, чтобы уменьшить выработку масла в вашей коже и минимизировать блеск.
  • Если у вас склонная к акне кожа или очень чувствительная кожа, выбирайте грунтовки на водной основе, потому что силиконовые могут засорить поры и вызвать прорывы или раздражение.
  • Используйте грунтовку с питательными ингредиентами и ту, которая содержит антиоксиданты для зрелой или стареющей кожи.

Это также отличная идея, чтобы попробовать, прежде чем купить! Если вы зайдете в Sephora, вы можете взять несколько образцов интересующих вас праймеров.Немного проб и ошибок необходимо, чтобы найти лучший выбор. Это было все о преимуществах грунтовки и о том, как использовать макияж грунтовку. Есть ли у вас учебник для начинающих или хитрости, которые помогут вашему макияжу оставаться на месте дольше? Дайте нам знать в комментариях ниже.

Ответы экспертов на вопросы читателей

Как долго будет длиться макияж, если я использую грунтовку?

Хороший учебник для начинающих заблокирует ваш фундамент на месте и увеличит его выносливость на 8 часов и более. Некоторые долгоживущие учебники обещают впечатляющие 15 часов макияжа.

Следует ли наносить праймер до или после увлажняющего крема?

Всегда наносите грунтовку после увлажнения лица. Это создаст барьер между вашей увлажненной кожей и основой.

Лучше ли использовать грунтовку без силикона?

Грунтовки на основе силикона помогают более эффективно размыть появление крупных пор и тонких линий. Но если у вас склонная к акне кожа или чувствительная кожа, лучше держаться подальше от грунтовки с силиконом и выбрать вариант на водной основе.

Есть ли отдельные праймеры для глаз и губ?

Да. Грунтовка век обычно имеет более густую консистенцию, чем грунтовка для лица. Эти продукты помогают наносить более ярко и предотвращают выпадение теней. Вы можете попробовать учебник для начинающих Benefit Stay. Грунтовка для губ обеспечивает более гладкое и равномерное нанесение цвета губ и предотвращает их выпадение. Попробуйте Perfoctor для заливки губ Becca.

Рекомендуемые статьи:
Была ли эта статья полезной?
Связанные Следующие две вкладки изменяют содержимое ниже.

Эша Саксена — писатель, журналист и постоянный сотрудник. Она имеет степень магистра в области средств массовой информации и массовых коммуникаций и твердо верит, что макияж — это не что иное, как искусство. Объединив свою любовь к письму со своей страстью к макияжу, она приносит вам обзоры, методы и свои постоянно растущие знания в этой форме искусства. В свободное время она любит читать, слушать малоизвестные инди-группы и писать стихи — все это, будучи сумасшедшей собакой.

Что такое праймер для краски и что делает праймер?

Что такое грунтовка для краски и что на самом деле делает грунтовка интерьера? Грунтовка помогает подготовить, запечатать и защитить поверхность, которую вы собираетесь покрасить, что приводит к улучшению внешнего вида внутренних и внутренних стен.

«Грунтовка работает для герметизации пятен, создания более гладкой и ровной поверхности и обеспечивает превосходную адгезию между верхним слоем и окрашиваемой поверхностью», — объясняет Джон Ким , менеджер по продукции в Dunn-Edwards.

Использование грунтовки также увеличит долговечность вашей краски. (Читайте: это будет меньше.)

Что такое праймер для краски, и нужно ли праймер перед покраской?

Хотя рисование на грунтовке может показаться обременительным, поскольку вы, по сути, выполняете двойную работу, это важный шаг для определенных проектов. Но не все рабочие места требуют учебника для начинающих; это зависит от нескольких факторов — включая поверхность, которую вы рисуете (есть ли плохое пятно?), тип краски, которую вы используете, и оттенок, который вы планируете покрыть.

Поэтому, прежде чем наносить один слой краски для внутренних (или наружных) поверхностей, помните о следующих правилах для начинающих.

Когда использовать грунтовку перед окраской

  • Вы рисуете темным цветом. Представьте себе, что вы пытаетесь закрасить гипсокартон светлым цветом, например, солнечно-желтым, на темно-фиолетовый оттенок, и вы быстро поймете, что грунтовка поверхности необходима при выполнении этого перехода. «В некоторых случаях, когда вы покрываете темный слой краски, вам может понадобиться тонированная грунтовка, чтобы новый выбранный цвет выглядел более правдоподобно образцу образца», — говорит Карен Грей-Плейстед из Design Solutions KGP.
  • Поверхность ваших стен (немного) грубая. Вы столкнулись с внутренним повреждением водой, пятнами плесени или жирными пятнами? Эти поверхностные пятна могут в конечном итоге просвечивать через светло-зеленый цвет, который вы купили, если вы сначала не используете грунтовку. «Существуют специальные грунтовки, такие как KILZ, которые обеспечивают лучшее покрытие, поэтому эти отметки не проникают сквозь ваш новый цвет», — подчеркивает Грей-Плейстед.
  • Вы красите новую поверхность. Новая гипсокартон, голое дерево или стена с новым обезжиренным покрытием (метод, используемый сухогрузами для покрытия пятен) — все они должны быть грунтованы.«Эти поверхности очень пористые и впитают вашу краску, если вы не начнете грунтовать первым», — говорит Ким. Грунтовка заполнит поры гипсокартона, улучшит адгезию и уменьшит количество слоев, которые вам понадобятся.
  • Вы планируете использовать латексную краску поверх масляной. Да, использование грунтовки поможет верхнему слою прилипнуть к глянцевой масляной краске. Спросите специалиста в магазине красок, какой грунт рекомендует выбранный вами производитель краски, так как грунтовки характерны для латексных или масляных красок, говорят эксперты.
  • У вас есть обои. Независимо от того, удалили ли вы слой бумаги или планируете закрасить существующие обои (да, вы можете сделать это!), Подготовьте учебник для начинающих. Снова, каждая из этих поверхностей находится на шероховатой стороне и извлечет выгоду из учебника для начинающих, который окрашен как основной слой.
  • Вы рисуете по металлу или пластику. «Использование металлического грунта защитит от ржавчины и послужит прочной основой для последующих слоев краски», — говорит Ким.

Когда вы можете пропустить грунтовку для покраски

  • Ваши стены в хорошем состоянии (без пятен). «Если вы покрываете гипсокартон, который ранее был окрашен латексом, и он в хорошем состоянии, без каких-либо следов или пятен, то вы, вероятно, можете уйти без использования грунтовки», — сообщает Darla DeMorrow из HeartWork Organizing.
  • Новая краска почти соответствует старой. Если вы наносите белый цвет поверх другого, похожего на окрашенный в белый цвет, вы можете обойтись без грунтовки.
  • Краска, которую вы выбрали , уже имеет грунтовку . «Некоторые новые краски, такие как марки Sherwin-Williams Duration и Emerald, представляют собой комбинации краски и грунтовки», — говорит Де Морроу. Данн-Эдвардс также делает самовсасывающую краску под названием Эверест.

Если вы сомневаетесь в том, заправлять или нет, добавьте это в свою работу покраски. Грунтовка не повредит внутренние (или внешние) стены, и у вас будет возможность попрактиковаться в мазках. Также проконсультируйтесь с производителем краски и, если нужно, заправьте, спросите, какая грунтовка является лучшей для оптимальной адгезии, и какая будет соответствовать выбранной вами краске.

Проникающая эпоксидная смола — Факты

Проникающая эпоксидная смола — Факты — Результаты испытаний

PROGRESSIVE EPOXY POLYMERS, INC.

АБСОЛЮТНЫЙ ЛУЧШИЙ ИСТОЧНИК для информации по эпоксидной смоле, варианты, продукция, произведенная в США

(ЭЛЕКТРОННОЕ ПИСЬМО 603435 7199)

ЧТО ЭТО ОБЛАСТИ САЙТА:

проникающий эпоксидная основа

Не дайте себя обмануть удивительным претензии.Проникающие эпоксидные смолы намного меньше, чем утверждают

Термин «проникающая эпоксидная смола» довольно расплывчатый. Обычно это эпоксидная смола с большим количеством добавленного растворителя. в растворитель (-ы) впитываются или проникают в древесину или что-либо еще, унося с собой некоторое количество эпоксидной смолы. Количество проникновения действительно меняется. Если растворитель или вода не впитаются очень глубоко в вашу поверхность, эпоксидная смола, разбавленная растворителем, не будет либо. Плохо проникает и на влажную или мокрую поверхность.Есть небольшая физическая причина для эпоксидной смолы / растворителя быть «втянутым» в область, заполненную водой. Проникающие эпоксидные смолы очень водянистые и обычно содержат больше растворителя. чем эпоксидная.

Ваш хозяин и Гид:

Пол Оман, MS, MBA — Прогрессивный Epoxy Polymers, Inc. (напольные эпоксидные смолы, морские эпоксидные смолы, эпоксидные смолы подводные, эпоксидные ремонтные)

Член: КДЕС (Национальная ассоциацияинженеров-коррозионистов), SSPC (Soc. of Protective Coatings)

Член правления: Друзья реки Санкук — 501 (c) (3) Некоммерческая организация —— Учредитель: Пятница Ночные гребцы.


Мы являемся единственной технологической компанией, основанной на покрытии / эпоксидной смоле. компания, которая активно поощряет ваш рабочий час телефонные звонки (восточное побережье), мы отвечаем на электронные письма 24/7/365. Мы формируем личные отношения с нашими клиентами и свободно поделитесь технической информацией, советами, продуктом информация и подсказки.Поговорите с технический специалист, не являющийся продавцом, с более чем 25 лет опыта в индустрии смол / покрытий.


Испытания на проникновение эпоксидной смолы


«Привет там! В этом письме нет вопросов, но я просто просматривал Ваш сайт и я хотел сказать, что это здорово! Я просто смотрел в Интернете, чтобы прочитать о эпоксидной смоле и ни о каком другом сайт, который я посетил, был так же полезен, как и ваш.Вы очень хорошо осведомлены в этой теме, и я восхищаюсь этим. Отличная работа и желаю вам Лучший! «- Габриэлла 10/15

Вы не найдете подобных рекомендаций на других сайтах!


ОСНОВЫ:


Термин «проникающая» эпоксидная смола довольно расплывчатый.Обычно это эпоксидная смола с большим количеством добавленного растворителя. в растворитель (-ы) впитываются или проникают в древесину или что-либо еще, унося с собой некоторое количество эпоксидной смолы. Количество проникновения действительно меняется. Если растворитель или вода не впитаются очень глубоко в вашу поверхность, эпоксидная смола, разбавленная растворителем, не будет либо. Плохо проникает и на влажную или мокрую поверхность. Есть небольшая физическая причина для эпоксидной смолы / растворителя быть «втянутым» в область, заполненную водой. Проникающие эпоксидные смолы очень водянистые и обычно содержат больше растворителя. чем эпоксидная.


Эпоксидные грунтовки — это эпоксидные смолы, разбавленные растворителем, которые часто используются для герметизации или стабилизации поверхности древесины / стекловолокна и т. Д. покрыть эту поверхность какой-нибудь краской или покрытием, в том числе эпоксидной смолой. Большая разница между праймерами а проникающие эпоксидные смолы (в самом общем смысле) — это количество растворителя. Грунтовки обычно содержат 10-25% растворителя. в то время как проникающие эпоксидные смолы содержат 50-75% растворителя.


Растворители дешевле эпоксидной смолы, поэтому теоретически эти продукты должны быть дешевле обычных эпоксидных смол, не содержащих растворителей.Обычно это не так. Вы можете сделать свой собственный грунт или проникающую эпоксидную смолу, добавив растворитель примерно в любая эпоксидка. Хотя логично начать с тонкой водянистой эпоксидной смолы, а затем добавить растворитель (например, нашу эпоксидную смолу с низким V), Я бы просто использовал более толстую морскую эпоксидную смолу, если бы она была у меня в наличии.


Сколько растворителя в вашей эпоксидной смоле? Большинство обычных эпоксидных смол не содержат растворителей. Проникающие эпоксидные смолы покажут, как много растворителя они содержат несколькими способами. Рассмотрим 10 унций проникающей эпоксидной смолы.Количество растворителя Содержит можно идентифицировать несколькими способами. Все следующее передает примерно одинаковую информацию: 30% твердых веществ, 70% ЛОС, 700 г / л (грамм на литр), 6 фунтов / галлон ЛОС. Этот продукт состоит примерно из 3 унций эпоксидной смолы и 7 унций растворители.


Немного о гнили. Древесная гниль часто возникает из-за сырости, и часто эта влажность не полностью высохла. прочь при ремонте. Лучше всего выбросить как можно больше гнилого дерева, убить оставшиеся. гнить грибок, пропитав место антифризом.Дайте высохнуть (недели), затем закройте эпоксидной смолой, разбавленной растворителем (грунтовкой или проникающей, вероятно, не имеет значения), затем заполните отверстие куском дерева или внешней замазкой (эпоксидная шпатлевка, как правило, слишком трудно шлифовать легко), затем покрасьте. Подробнее о гнили — КЛИКНИТЕ СЮДА.


Нагревание эпоксидной смолы снижает ее вязкость и улучшает проникновение. То же самое и согревание поверхности, на которой применительно к. Когда объект охлаждается, воздух в нем сжимается, помогая втягивать эпоксидную смолу в объект.


Эпоксидные смолы доказали свою ценность в качестве «герметика», «грунтовки» или «грунтовки» для красок или лаков. Нет специального продукта здесь нужен. На мой взгляд, практически любая эпоксидная смола, разбавленная или не разбавленная, удовлетворительно справится с этой задачей. манера.


Из-за отсутствия истинного проникновения во что-либо, кроме очень сухой древесины с торцевыми волокнами, а также из-за свежего воздуха законы и правила качества (VOC), термины «проникающий» и «грунтовка» редко используются производства наших дней.Теперь их чаще называют «усилителями сцепления» и / или «герметиками». Мы признаем это, а наши конкуренты — нет!


Не дайте себя одурачить «из этого мира»

претензий по исполнению…



Мои наблюдения:



1) Даже небольшое количество растворителя заметно увеличивает проникновение эпоксидной смолы.

2) Растворители и смеси растворителей обычно работают примерно одинаково для меня в мои тесты. Ксилол, казалось, работает хорошо (лучше всего), и его легко приобрести в местном хозяйственном магазине. Быстро стало растворитель, который я использовал в большинстве своих тестов.Я заплатил около 15 долларов за галлон ксилола в местном хозяйственном магазине.

3) Эпоксидные смолы с более низкой начальной вязкостью до разбавления, лучше проникают (и были тоньше), когда к ним добавляли растворители (здравый смысл).

4) Даже небольшое количество растворителя сильно повлияло на эпоксидный гель / время схватывания. С участием только 10% -15% растворителя время, необходимое для схватывания эпоксидной смолы (в слое толщиной 0,5-1,0 дюйма внутри открытого широкоформатного отверстия, пинты) увеличилась с нескольких часов (без растворителя) до 1-2 дней.С большим количеством растворителя время гелеобразования может увеличиться до 4 дней.

5) Добавление растворителя сделало полученный блок эпоксидной смолы очень эластичным. При 10% этот эффект эластичности был минимальным и постепенно исчезал. При 15% осталась небольшая просадка эпоксидных блоков. При 33% эпоксидная смола превратилась в эластичный блок. При 50% или выше результат был «Желе». «Желе» потребовалось несколько дней. формировать.

6) Некоторые эпоксидные смолы больше подвержены влиянию добавление растворителя для их разбавления.Добавление растворителей в эпоксидные смолы изменит жизнеспособность эпоксидной смолы. Для большинства эпоксидных смол это изменение драматическое. Но с циклоалифатические эпоксидные смолы, в которых используются кольцевые молекулы, влияние меньше драматический. Жизнеспособность не увеличивается так сильно, как у «обычных» эпоксидных смол. Наш Эпоксидный герметик и грунтовка ESP 155 — это циклоэпоксид высокого класса с содержанием около 24% растворитель. Добавление большего количества растворителя не сильно влияет на рабочее время (жизнеспособность). много. Итог: использование чего-то вроде ESP 155 может быть лучшим вариантом чем добавление растворителя в другие эпоксидные смолы (например, наши LOW V или Basic No Blush), если вы хотите, чтобы рабочее время (жизнеспособность) не было чрезмерно долгим (и эпоксидная смола возможно, более «повреждены» растворителем).Тем не менее, большинство людей устраивает разбавление ЛЮБОЙ эпоксидной смолы растворителем — особенно в теплую погоду, которая сильно сократить жизнеспособность.


Подробнее о проникающих эпоксидных смолах

Примерно каждый год я по-новому смотрю на проникающие эпоксидные смолы, в том числе на продукцию наших конкурентов. Нашего конкурента продукт (назовем его «ABCD») представляет собой проникающую эпоксидную смолу с почти культовым статусом. Его материал паспорт безопасности (MSDS) показывает, что это смесь растворителей (см. приложение), составляющая около 69% продукта, и около 31% эпоксидной смолы.В паспорте безопасности растворители перечислены в порядке убывания (или количествах). Как ни странно, первичный (первый в списке) растворитель идентифицируется только по его химическому классификационному номеру, в то время как все другие растворители идентифицируются по их общему названию. Первый растворитель — это «ароматический углеводород», который отслеживается по номеру CAS, Этот продукт представляет собой нефтяную нафту типа 1. Второй — в ксилоле, очень распространенном (и нашем любимом) растворителе для эпоксидной смолы. и тоньше. Затем идет толуол, еще один очень распространенный растворитель для красок. Далее идет изопропиловый спирт (обычный растворитель, продается как в отделениях красок, так и в аптеках).Очень вероятно, что эти 4 очень распространенных растворителя составляют большую часть растворителей в продукте (в процентах), хотя также включены 15 дополнительных растворителей. Подробнее о растворителей в этом продукте —

Нажмите Здесь.

Интересно, а почему столько растворителей? Возможно, чтобы отговорить кого-либо от создания собственной версии ABCD. В моем прошлом и В текущем раунде тестирования я не обнаружил огромных различий в характеристиках нескольких различных растворителей. Я использовал в своем тесте на проникновение, хотя некоторые из них работали немного лучше, чем другие.

Также наш продукт (ESP 155) использует очень высокий конец циклоалифатическая эпоксидная смола — вместо эпоксидных смол очень низкого уровня, которые можно найти в других эпоксидных смолах, разбавленных растворителем этот вид. Вышеупомянутый бренд использует так мало эпоксидной смолы, что даже не предлагает информации о эпоксидной смоле. в его листе msds.


Почему ESP 155 эпоксидная смола герметик а также грунтовка является в ЛУЧШИЙ в это класс:

1) Использует начальство ЦИКЛОАЛИФАТИЧЕСКИЙ лечение агенты а также эпоксидная смола ADDUCT рецептура

2) растворитель на основе для лучше проникновение

3) влага терпимый, очень низкий вязкость

4) сильный Пользователь служба поддержки / обратная связь

4) 24/7 поддержка


КАК Я ПРОВЕИЛ ИСПЫТАНИЯ:


Обычно я смешивал образцы для испытаний весом 6 унций в пластиковых стаканчиках.Я измерил проникновение, вставив картонную полоску в тестовый образец и наблюдая, как далеко продвинулся тестовый раствор по полоске. Тестовый раствор перевернул картон от светло-коричневого до темно-коричневого. Этот темный цвет сохранялся еще долго после того, как растворитель мог испариться. картон вернулся в исходный цвет (такого никогда не наблюдалось). Аналогичные результаты были получены при перемешивании деревянной краски. прилипает к растворам, хотя эффекты были более выраженными и легче наблюдались при использовании картона.




ЗАМЕЧАНИЯ / НАБЛЮДЕНИЯ:


Я всегда задавался вопросом, почему в ABCD так много растворителя и так мало эпоксидной смолы. Разбавление эпоксидной смолы на 10-25% растворителем кажется намного разумнее.Однако я заметил, что проникновение значительно увеличивается, когда% растворителя (по объему) превышает этот процент эпоксидной смолы. Другими словами, более растворителем, чем эпоксидная смола. Для меня это было что-то новенькое. я все еще верю что для грунтовочных поверхностей 10-25% разбавление является правильным, но цель — максимальное проникновение, первый слой должен быть избыток растворителя.

Для своих первоначальных тестов я использовал нашу эпоксидную грунтовку ESP 155, которая уже составляет ок. 24% растворитель. Затем я добавил равное количества растворителя для ESP, поэтому общий% растворителей в моих тестовых примерах составлял около 74% (vs.около 69% для ABCD). Этот продукт представляет собой прогрессивную эпоксидную смолу. Polymers, Inc. самый продаваемый, любимый продукт. Посетите наши ИЗБРАННЫЕ — 7 ЭПОКСИДЫ, КОТОРЫЕ УПРАВЛЯЮТ ЛЮБУЮ веб-страницу в: epoxyproducts.com/favorites4u.html Посмотреть другие популярные уникальные продукты.

В течение последнего года или около того я подозревал, что нафта, возможно, является «секретным ингредиентом» в ABCD (если она действительно секретный ингредиент производительности). Когда я тестировал нафту в качестве единственного растворителя, я обнаружил, что она не смешивается с эпоксидная смола.Большая его часть отделяется от эпоксидной смолы. Я решил проблему разделения, используя смесь 50-50 нафты. и ксилол. Однако я также заметил, что использование всего ксилола дает лучшее и более быстрое проникновение. К моему удивлению проникновение, наблюдаемое с помощью ABCD, явно было «серединой пачки» или меньше.


Изопропиловый спирт — это один из растворителей, который можно смешивать с водой. Это наводило на мысль, что это может быть лучший растворитель. внутри или на влажных поверхностях. Я повторил свои тесты, используя влажный картон и 1 емкость со спиртом в качестве единственного растворителя. один только с ксилолом, а другой с 50-50 смесью ксилола и спирта.Я также налил немного воды на каждый тестовый стаканчик. Несколько удивительно, что смесь, содержащая только ксилол, по-прежнему дает наилучшее проникновение. Также удалось чтобы включить воду, я добавил в смесь. После нанесения эпоксидной смолы в чашке не наблюдалось отдельно стоящей воды. загустел. В пробной чашке, содержащей только спирт, была бесплатная вода.




ВЛИЯНИЕ БОЛЬШИХ КОЛИЧЕСТВ РАСТВОРИТЕЛЕЙ В ЭПОКСИДАХ


Когда эпоксидная смола, разбавленная растворителем, наносится тонким слоем или пропускается через пистолет-распылитель, я подозреваю, что большая часть растворитель испаряется до того, как смола застынет.Когда эпоксидная смола и растворитель смешаны и оставлены чашка, испарения очень мало. Эпоксидная смола медленно (очень медленно) начинает затвердевать и превращаться в желе. (тм). Со временем это станет немного тяжелее (как яйцо вкрутую), но я никогда не видел, чтобы оно становилось твердым (даже с образцами месячной давности). Предупреждение: не добавляйте в эпоксидные смолы растворители, которые вам нужны для прочности. Растворители ослабит эпоксидную смолу, но также придаст ей гибкость.


УСТАНОВИТЬ ВРЕМЯ


Как указано выше, эпоксидная смесь с содержанием растворителя от 65 до 75% требует длительного времени для затвердевания или образования геля.В моих тестах над ним Обычно для образования геля в чашках требовалось около 40 часов. Исключением был ABCD. Для образования геля потребовалось от 80 до 90 часов. Это уникальный атрибут ABCD? Я не могу представить себе никакой пользы от жизнеспособности 90 часов по сравнению с 40 часами жизнеспособности. По-прежнему, возможно, это как-то улучшает реальную производительность.

Я решил попытаться соответствовать продолжительному сроку жизни ABCD. Я сделал это, используя в качестве основной эпоксидной смолы нашу эпоксидную смолу Summer Bond — морская эпоксидная смола, не содержащая растворителей, разработанная для жаркой погоды. Другими словами, он затвердевает медленнее, чем другие эпоксидные смолы, поэтому он имеет более длительную жизнеспособность в теплую погоду (фактически более длительную жизнеспособность при любых условиях).Потому что эта эпоксидная смола начинается Без растворителя я добавил 2 части растворителя к 1 части эпоксидной смолы. Это дало мне окончательный процент растворителя 66%. Это также дало мне время жизнеспособности 80-90 часов, наблюдаемое с ABCD.


ВЫВОДЫ


Максимальное проникновение в проникающие эпоксидные смолы достигается, когда растворители составляют 65-75% смеси. Ксилол обыкновенный оказывается лучшим растворителем для использования.Хотя любую эпоксидную смолу можно разбавить и использовать, мы рекомендуем нашу эпоксидную смолу ESP 155. (который уже содержит некоторые растворители, представляет собой смесь 1: 1 и продается в ½ галлонах) в равных количествах ксилола — легкая в приготовлении смесь. Если кто-то хочет исключительно долгой жизнеспособности (что, кажется, не так уж и много) проблемы, возможно) аналогично ABCD, используйте нашу эпоксидную смолу Summer Bond для теплой погоды, которая представляет собой смесь 3: 1 и продается в 1 галлонах единицы измерения. К каждой единице смешанной эпоксидной смолы Summer bond добавьте 2 единицы ксилола. — Примечание: летняя облигация больше не доступна (1/2007)

Сделав собственную проникающую эпоксидную смолу, разбавленную растворителем, вы можете сэкономить от ½ до 2/3 стоимости покупки ABCD.


Нагревание эпоксидной смолы снизит ее вязкость и улучшит проникновение. То же самое и согревание поверхности, на которой применительно к. Когда объект охлаждается, воздух в нем сжимается, помогая втягивать эпоксидную смолу в объект.

В качестве «герметика», «грунтовки» или «грунтовки» для красок или лаков эпоксидные смолы имеют доказали свою ценность. Никакого специального продукта здесь не требуется. На мой взгляд, практически любая эпоксидная смола, разбавленная или не разбавленная, выполнит эту задачу удовлетворительным образом.



Предупреждение: исследуя эту тему, я разговаривал с другими полными время профессионалов эпоксидной смолы как внутри, так и за пределами морской индустрии. Мне наглядно напомнили о здоровье опасность и воспламеняемость растворителей. Будьте предельно осторожны при работе с ними в моторных отсеках, ограниченном пространстве, и в отапливаемых открытым пламенем рабочих зонах.


ЮРИДИЧЕСКОЕ УВЕДОМЛЕНИЕ. Существуют ограничения на федеральном уровне, уровне штата, а иногда и округа на использование растворителей.С высоким содержанием растворителя продукты, как правило, являются незаконными на всей территории США. «Исправление» со стороны этих поставщиков — использование некоторого «низкого уровня (???)» растворители, не подпадающие под действие правил. Таким образом, вместо хорошего продукта вы можете получить «легальный» продукт. Подробнее об ограничениях по ЛОС (растворителям) см .: http://www.epoxyproducts.com/voc.html. Обратите внимание, что если вы добавляете растворители в продукты и тем самым превышаете нормативы по ЛОС в вашем регионе, вы технически Нарушать закон.



Дополнительные испытания двухкомпонентного проникновения

Системы эпоксидных смол и их содержание растворителей


В этом новом раунде испытаний я использовал мягко утрамбованный песок для «тестирования». средний, поскольку он имел однородную пористость, повторяемую образец за образцом.

Были использованы четыре различных тестовых эпоксидных смолы, равномерное количество каждого нанесено на поверхность песка. После того, как эпоксидная смола застыла, я измерил вес каждого «комочка песка» как индикатор проникновения.


Образец 1 — промышленная проникающая эпоксидная смола с уровнем растворителя приблизительно 70% — (два испытания) масса песка 75-80 грамм

Образец 2 — эпоксидная смола ESP 155 (уровень растворителя 25%) — масса песка 60-65 грамм

Образец 3 -ESP 155 с дополнительным растворителем (прибл.70% растворителя) — песок массой 70-75 граммы

Образец 4 — эпоксидная смола с низким V (низкая вязкость), не содержащая растворителей — песок, масса 50 грамм


ПРИМЕЧАНИЯ: большие массы песка образцов 1 и 3 (с низким содержанием эпоксидной смолы) легко разрушаются. Более высокие% массы эпоксидной смолы сделали не разламывается легко.

ВЫВОДЫ: больше растворителя означает большее проникновение, но меньшую прочность.

«Проникающие / грунтовочные» продукты, предлагаемые Progressive Epoxy Polymers, Inc.


LOW V ™ (тонкий, без растворителей эпоксидная смола — добавьте к ней растворитель, чтобы получилась проникающая или грунтовочная смола) — Нажмите здесь

ESP 155 ™ (собственная бесцветная грунтовка эпоксидная смола с ок. 25% растворитель — добавьте больше растворителя для эпоксидной смолы, которая легко проникает) — Нажмите здесь


Заказать любой из этих Продукты СЕЙЧАС

в нашем большом интернет-магазине



Вопросов? / Заказ по телефону? / ЭЛЕКТРОННАЯ ПОЧТА / ЗВОНОК 603-435-7199 EST / КУПИТЬ ОНЛАЙН


ПОИСК ПО САЙТУ GOOGLE — Нажмите здесь Поиск по сайту для эпоксидной смолы


Нажмите здесь — видео на YouTube.Узнать о Прогрессивный Эпоксидная смола Полимеры Inc.


EVAL4U — как оценить вашу эпоксидную смолу продавец — НАЖМИТЕ ЗДЕСЬ —


Прогрессивная эпоксидная смола Polymers, Inc.

Находится в районе Без налога с продаж — Нью-Гэмпшир (домашняя страница)

ЭПОКСИДНЫЕ КРАСКИ И СМОЛЫ

1 И 2 ​​ЧАСТИ УРЕТАНА — ПОКРЫТИЯ

«Правильная эпоксидная смола исправляет все!»

Посетите нашу тему / содержание каталога СТР.


The Flood Company Australia »Средства по уходу за деревом» введение

Именно потому, что вы действительно цените древесину в

жизни, она заслуживает лучшей защиты
, которую вы можете дать.
Как люди, мы инстинктивно защищаем себя и, что особенно важно, свою кожу от непогоды — солнца, дождя, снега и т. Д. Но подумайте о жизни с точки зрения дерева. Он так же уязвим к стихиям, как и наша кожа, однако его оставляют на открытом воздухе, часто 365 дней в году, в экстремальных условиях. Дерево проходит через многое, чтобы обогатить нашу жизнь — все, что он требует взамен, — это временный слой защиты.

Защита ваших инвестиций

Ваш дом — это, пожалуй, самая большая инвестиция, которую вы делаете.Это ценный актив, и он должен выглядеть красиво. Для этого вам необходимо защитить деревянные настилы, деревянную облицовку, беседки и заборы. Независимо от того, новые они или старые, эти поверхности постоянно подвергаются разрушительному воздействию дождя и солнца, которое может вызвать растрескивание, выцветание, расщепление, коробление и деформацию. Все, что снижает стоимость вашего дома. Вот почему так важно защитить и восстановить эти деревянные поверхности с помощью средств по уходу за деревом от The Flood Company Australia.

Системы ухода за заливным деревом

Каждый продукт по уходу за деревом от The Flood Company по отдельности обладает определенными преимуществами для всех ваших деревянных поверхностей. Dekswood, PowerLift, WoodPrep и Spa-N-Deck предоставляют полную систему ухода за деревом. Система, благодаря которой ваша палуба, навесные доски, заборы и другие внешние деревянные поверхности выглядят так, как должны. Естественно красиво. С первого дня и на протяжении всей жизни вашего дерева.

Получите долгосрочную окупаемость своих инвестиций

Короткое время, которое вы потратите на защиту своей древесины с помощью линии средств по уходу за деревом Flood, даст вам то, чего вы хотите больше всего: красивую внешнюю древесину, которая прослужит долго.

Сколько стоит

Нас часто спрашивают, сколько будет стоить обработка палубы, чтобы дорогая древесина была защищена и выглядела красиво.

На этот вопрос нет однозначного ответа, поскольку стоимость различных доступных продуктов сильно различается. Цифра шарикового парка будет составлять 10 долларов за кв. М для качественной масляной отделки и герметика и в два раза больше для более прочной отделки. Следует учитывать ожидаемую продолжительность финиша. Если масляная отделка настила может нуждаться в повторном покрытии каждые 6 месяцев, более долговечная отделка, такая как современные акриловые типы, может иметь срок службы 2 года или более, прежде чем потребуется повторное нанесение.Простая арифметика говорит нам, что они, хотя и обходятся дороже вначале, дешевле в долгосрочной перспективе, требуют гораздо меньше работы и доставляют вам больше удовольствия, сохраняя вашу колоду красивой в течение гораздо более длительных периодов времени.

Лучшие методы снижения вязкости

Как разбавить эпоксидную смолу и на что обратить внимание перед тем, как делать это

Уменьшение вязкости эпоксидной смолы WEST SYSTEM® путем добавления растворителя может быть заманчивым. Раскатать становится легче; глубже проникает в пористые поверхности, например, частично гнилую древесину; и быстрее впитывается в такие материалы, как стекловолокно.

Но — и это большое «но» — снижение вязкости также может изменить характеристики эпоксидной смолы, влияя как на ее прочность, так и на влагостойкость. Это также влияет на время, необходимое эпоксидной смоле для образования геля.

Итак, прежде чем вы решите разбавить эпоксидную смолу, важно взвесить преимущества и потенциальные риски. Затем, если вы хотите продолжить, вам нужно решить, разбавлять ли эпоксидную смолу нагреванием или растворителем.

Некоторые распространенные заблуждения о разбавлении эпоксидной смолы

Технический персонал West System International часто разговаривает с клиентами, которые считают, что эпоксидная смола должна глубоко проникать в древесину, чтобы быть эффективной.Хотя иногда это так, в большинстве случаев это не так — и клиенты думают о разбавлении эпоксидной смолы, когда это может быть нецелесообразно.

Например, аккуратное эпоксидное покрытие на поверхности обеспечивает гораздо лучшую водостойкость, чем разбавленная эпоксидная смола, потому что разбавленная эпоксидная смола имеет тенденцию становиться пористой. Точно так же адгезия зависит от площади поверхности шва, прочности древесины и прочности используемого клея, а не, как многие полагают, от глубокого проникновения эпоксидной смолы. А когда дело доходит до гнилой древесины, хотя разбавленная эпоксидная смола, безусловно, делает ее более твердой, она не восстанавливает свою первоначальную прочность.

Итак, если вы думаете о разбавлении эпоксидной смолы по любой из этих причин, возможно, пришло время подумать еще раз. В противном случае вот что вам нужно знать, чтобы эффективно разбавить эпоксидную смолу:

Разбавление эпоксидной смолы нагреванием

У вас есть два варианта, если вы хотите разбавить эпоксидную смолу нагреванием. Вы можете нагреть компоненты смолы и отвердителя по отдельности, а затем смешать их вместе, чтобы получить разбавленную эпоксидную смолу. Или вы можете нагреть основание — например, дерево — и нанести смесь смолы и отвердителя комнатной температуры на нагретую поверхность.

Нагретая смесь смолы и отвердителя сохраняет все характеристики эпоксидной смолы, отвержденной при комнатной температуре, но затвердевает быстрее, что может вас удивить. Использование WEST SYSTEM 206 Slow Hardener® или WEST SYSTEM 209 Extra Slow Hardener® может помочь, поскольку эти два отвердителя имеют медленную скорость отверждения, что дает вам больше времени для работы с теплой эпоксидной смолой.

Но если вы покрываете дерево, лучший метод — это его прогреть, а не эпоксидную смолу. Удалите источник тепла непосредственно перед нанесением эпоксидной смолы, и смесь станет жидкой при контакте с деревом.Когда древесина охлаждается, эпоксидная смола глубоко втягивается до гелеобразования, так как воздух в древесном волокне сжимается.

Какой бы метод вы ни использовали, вы должны иметь возможность удобно прикасаться к контейнерам с эпоксидной смолой или дереву, поэтому нагрейте их максимум до 35˚C. Перегрев приводит к слишком быстрому затвердеванию эпоксидной смолы. Если вы видите дым, поднимающийся от застывшей эпоксидной смолы, вероятно, она повреждена и нуждается в замене.

Разбавление эпоксидной смолы растворителем

В то время как нагревательная эпоксидная смола может позволить вам сохранить первоначальные характеристики эпоксидной смолы, добавление растворителя, такого как ацетон, разбавитель для лака или денатурированный спирт, может привести к радикальным изменениям. Мы не рекомендуем разбавлять эпоксидную смолу растворителем в любое время , и вот почему:

  • Добавление 5% разбавителя лака к эпоксидной смоле снижает ее прочность на сжатие на 35%. Таким образом, он больше не подходит в качестве структурного клея.
  • Добавление растворителя может увеличить время отверждения, делая вашу работу непредсказуемой.
  • Добавление растворителя может привести к усадке и растрескиванию смолы со временем. Это происходит, если растворитель не испаряется до затвердевания эпоксидной смолы, но со временем выходит из смеси.
  • Добавление растворителя, такого как ацетон, может изменить цвет застывшей эпоксидной смолы.
  • Добавление растворителя может повредить такие субстраты, как пенополистирол, поэтому перед разбавлением эпоксидной смолы проверьте свой растворитель на субстрате.
  • Добавление растворителя может увеличить риск возгорания и нанести вред вашему здоровью.
  • Добавление растворителя для быстрого смачивания стекловолокна может привести к образованию ткани с недостатком смолы, если избыток эпоксидной смолы стекает с вертикальных поверхностей.

В целом, мы рекомендуем разбавлять эпоксидную смолу нагреванием, потому что это может позволить вам сохранить первоначальные характеристики эпоксидной смолы.

Но эта рекомендация всегда сопровождается предупреждением: разбавляя эпоксидную смолу, вы изменяете состав продуктов WEST SYSTEM, которые совершенствовались в течение многих лет. Это не значит, что вам никогда не следует этого делать, но это означает, что вам нужно думать и действовать осторожно, когда вы это делаете.

Хотите узнать больше? Прочтите наше руководство по использованию эпоксидных материалов WEST SYSTEM.



эссенций для лица | Что такое эссенции для лица и как они работают?

Вы, наверное, уже знакомы с корейской красотой, даже если не осознаете этого.Использовали листовую маску в прошлом году? Вероятно, это пришло из Южной Кореи. То же самое и с масками для сна, экстрактами улиток и пластырями от прыщей, от которых мы просто не можем насытиться (если вы еще не попробовали их, отправляйтесь прямо к Зитстика — они для меня откровение).

Но эссенции для лица — это одна из тенденций, рожденных в Корее, о которой мы не дошли. Те, кто занимается уходом за кожей, будут знать, что они переходят между тонированием и нанесением сыворотки, но что такое эссенция для лица? А что они на самом деле делают?

Что такое эссенция для лица?

«Эссенция для лица, созданная в корейской индустрии красоты, — не путать с тоником — по сути, работает как праймер для вашего увлажняющего крема, а также имеет множество дополнительных преимуществ для кожи», — объясняет Юлия Маринкович, представитель COSRX в Великобритании. .

«Эссенции имеют те же преимущества, что и сыворотка, и обладая более низкой молекулярной массой, чем большинство ежедневных кремов, они работают, чтобы проникать в кожу глубже, чем ваш средний увлажняющий крем», — говорит она. «Эссенции объединяют в себе различные элементы повседневного ухода за кожей за один шаг: они увлажняют и восстанавливают баланс кожи, в то же время используя высококонцентрированные уровни активных ингредиентов, что обеспечивает более глубокое проникновение в наш кожный барьер. Это дополнительное увлажнение позволяет вашей коже впитывать все полезные свойства следующего продукта даже в большей степени, чем обычно.’

Итак, откровенно говоря, эссенция в основном используется для усиления преимуществ всех других продуктов в вашей повседневной жизни. «Активные ингредиенты будут проникать еще глубже в кожу, работая над улучшением других продуктов по уходу за кожей, делая все это намного более эффективным», — говорит Маринкович. Более того, если вы пытаетесь получить супергидратированную, влажную кожу, известную как фильтр Insta, легкий слой увлажняющей эссенции станет вашим ключевым союзником.

Как использовать эссенцию для лица

Говоря об эффективности, правильное нанесение также имеет решающее значение — а это означает отказ от ватных дисков.«Некоторым людям нравится наносить 2-3 насоса на ватный тампон и наносить его на лицо, но это означает, что большая часть эссенции просто остается на вашем тампоне, и вы в конечном итоге тратите довольно много продукта», — говорит Маринкович. Когда дело доходит до применения, она рекомендует обращаться с эссенцией как с сывороткой: «распылить 4-5 доз эссенции на ладони, а затем аккуратно вдавить продукт в кожу, стараясь не тянуть».

Лучшие эссенции для лица, которые стоит попробовать сейчас

Как и все в уходе за кожей, теперь существует бесконечный выбор эссенций для лица, каждая из которых имеет дополнительные преимущества, подходящие для определенного типа кожи.Здесь вы найдете лучшие из тех, что мы пробовали, и типы кожи, которые им подходят.

Эссенция Vital Hydra Solution Essence

Стойкие приверженцы K-Beauty Доктор Джарт предлагает эту блестящую эссенцию для лица, в которой используются пробиотики, которые повышают водный барьер, сохраняя при этом спокойный и сбалансированный темпераментный цвет лица. Гиалуроновая кислота тройного веса увеличивает количество клеток на нескольких уровнях — замечательная технология ухода за кожей по такой разумной цене.

Гель-эссенция Advanced Snail 96 Mucin Power Essence Gel

Не думайте о том, что наносите на лицо, просто знайте, что это великолепный гидратор, который поможет вам достичь «стеклянной кожи» быстрее, чем что-либо еще.Вы знаете, что он содержит 96% муцина улитки и не содержит наполнителей. (Даже Эмили Ратаковски в восторге от этого.)

Хорошо, хорошо, если вы не можете преодолеть фактор раздражения, попробуйте не менее хорошую эссенцию гиалуроновой кислоты от этой марки.

Набор эссенции Timeless Ferment Snail

Этот южнокорейский фаворит также насыщен увлажняющим секретом улиток, но усилен гликолевой кислотой, эластином и ниацинамидом.У него более жирная текстура, чем у COSRX, поэтому используйте его, когда кожа кажется особенно сухой.

Концентрированная осветляющая гликолевая эссенция Vinoperfect

Предложение

Caudalie необычно тем, что оно сосредоточено на отшелушивании, что делает его идеальным для всех, у кого комбинированная или жирная кожа. Он содержит гликолевую кислоту, которая мягко растворяет омертвевшие клетки кожи и сохраняет поры чистыми, обеспечивая сияние, которое никогда не кажется жирным.

Эссенция для ухода за лицом с черным чаем и чайным грибом

Отличный выбор для тех, кто живет в застроенном городе. В его состав входят нейтрализующие загрязнение антиоксиданты и ферментированные экстракты, чтобы сохранить ваш кожный барьер здоровым и счастливым. Для вашей кожи это гораздо больше, чем литр чайного гриба.

Активная лечебная эссенция

Дочь винодела

210 фунтов стерлингов.00

Цена может быть ошеломляющей, но здесь вы платите за действительно эффективные натуральные ингредиенты. Каждая бутылка Powerhouse содержит 30 тщательно извлеченных растительных ингредиентов — от гиалуроновой кислоты до пробиотиков, — которые работают в синергии, чтобы осветлить и укрепить кожу.

Тоник Essence

Этот южнокорейский основной продукт содержит значительную (на самом деле 91%) концентрацию экстракта астрагала, который широко используется в традиционной восточной медицине из-за его противовоспалительных свойств.Обладая текстурой, более похожей на тоник, он впитывается, увлажняя и успокаивая кожу любого типа.

Увлажняющая цветочная эссенция

Тата Харпер Космический НК

82,00 фунта стерлингов

Бесспорно роскошная (с соответствующей ценой) цветочная эссенция Tata Harper — настоящее удовольствие. Он легче большинства, поэтому больше похож на увлажняющий туман, но при этом содержит гиалуроновую кислоту растительного происхождения, которая удерживает влагу еще до того, как вы дойдете до сыворотки.

Сущность розового напитка

Сывороточная эссенция Sunday Riley — это не просто умный гидратор, она содержит пептиды, которые способствуют лучшему производству коллагена, а также пребиотики, регулирующие биом. С керамидами и успокаивающим экстрактом огурца это очень полезный вариант для тех, кто хочет уменьшить расширенные поры или решить проблему неровной текстуры.

Сущность, восстанавливающая равновесие

Когда косметические бренды обращаются к уходу за кожей, результат не всегда впечатляет, но новая линия Hourglass в значительной степени является триумфом.Эта эссенция, в частности, может похвастаться списком ингредиентов без наполнителей, включая связывающие воду растительные увлажнители, веганские липиды и смягчающие средства для барьерного питания. Для пухлой сияющей кожи это стоит попробовать.

Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты. Вы можете найти больше информации об этом и подобном контенте на сайте piano.io.

h30 Эпоксидная грунтовка для быстрого отверждения HyperPRIME | 1-часовой повторный слой

ИНСТРУКЦИЯ ПО СМЕШИВАНИЮ И НАНЕСЕНИЮ

ХРАНЕНИЕ ПРОДУКТА : Продукт должен храниться в месте, где температура продукта будет доведена до комнатной перед использованием.Температура непрерывного хранения должна составлять от 60 до 90 градусов по Фаренгейту. Не допускать замерзания.

ПОДГОТОВКА ПОВЕРХНОСТИ : Методы подготовки могут различаться в зависимости от применяемой системы. Для полной толщины системы, превышающей 10 мил в сухом состоянии, рекомендуется тонкая струйная очистка (дробеструйная обработка). Чтобы обеспечить надежное соединение, необходимо удалить всю пыль, масло, грязь, посторонние примеси и цементное молоко. Рекомендуется провести испытание на влажность, чтобы определить, имеет ли бетон соответствующий пароизоляционный слой.Это можно сделать, поместив пластиковый лист размером 4х4 дюйма на основу и заклеив края скотчем. По прошествии 24 часов, а субстрат под пластиковым листом все еще остается сухим, субстрат не показывает признаков возможных проблем с гидростатическим давлением, которые впоследствии могут вызвать отслоение. Однако это испытание не гарантирует, что в будущем не возникнет проблем с гидростатическим давлением.

СМЕШИВАНИЕ ПРОДУКТОВ : Этот продукт поставляется расфасованным по весу. Наборы следует полностью перемешать.Если должны использоваться частичные комплекты, соотношение смешивания составляет 4 части A к 1 части B. После того, как две части будут объединены, хорошо перемешайте с помощью низкоскоростного смесительного оборудования до тех пор, пока материал не будет тщательно перемешан и не останется полос. Избегайте попадания воздуха в покрытие. Неправильное смешивание может привести к выходу продукта из строя. Для достижения наилучших результатов смешивания и правильного смешивания частей A и B рекомендуется дрель-миксер Jiffy Mixer.

НАНЕСЕНИЕ ПРОДУКТА : Используйте кисть или валик с ворсом 3/8 дюйма для нанесения смешанного материала методом окунания и валика.Поддерживайте температуру в рекомендуемых диапазонах во время нанесения и отверждения. Наносите материал с относительной влажностью в пределах параметров, указанных в технических характеристиках. По достижении конца жизнеспособности материала будет трудно наносить материал, продукт скатывается обратно на валик. Как только это произойдет, не продолжайте приложение. Прямой солнечный свет или высокие температуры могут стать причиной видимого деформирования валика во время нанесения. Нанесение слишком толстого продукта может привести к его поломке. .Если вы используете щетку для стружки по краям, рекомендуется провести по краям 9-дюймовый валик, чтобы выровнять текстуру и внешний вид пола. При нанесении покрытия на бетон норма расхода составляет 300-350 кв. Футов. на галлон. Если покрытие наносится поверх существующего покрытия, то укрывистость составляет 500-600 кв. Футов. на галлон.

ПОВТОРНОЕ ПОКРЫТИЕ ИЛИ ПОКРЫТИЕ: Допускается нанесение нескольких слоев этого продукта. Обратитесь к графику отверждения как к руководству, которому нужно следовать, однако лучше всего протестировать покрытие перед повторным или верхним покрытием.Это делается нажатием большого пальца на покрытие, чтобы отпечаток пальца не был виден. Если отпечатка не видно, то можно покрывать пол. Обратите внимание, что при более низких температурах требуется более длительное время отверждения, прежде чем на продукт можно будет наносить новое покрытие. Перед нанесением покрытия на пол убедитесь в отсутствии загрязнений. Если есть загрязнения или румянец, удалите его стандартным моющим средством и перед нанесением покрытия убедитесь, что пол чистый и сухой. При повторном покрытии этого продукта последующими слоями уретана или полиаспарагиновой кислоты обязательно убедитесь, что HyperPRIME полностью затвердел, в противном случае растворитель в верхнем слое повредит грунтовку и возникнут проблемы со связкой.При повторном покрытии этого продукта через 24 часа после нанесения грунтовка должна быть механически просеяна и устранена глянцевитость, чтобы гарантировать отсутствие проблем с адгезией между слоями.

ОЧИСТКА / ЧИСТКА ПОЛА : Для очистки используйте растворители. При мытье пола ВНИМАНИЕ! Некоторые чистящие средства могут повлиять на цвет уложенного пола. Проверьте каждый используемый очиститель на небольшой площади, чтобы убедиться в отсутствии повреждений. Ограничьте использование пола легким движением и использованием неагрессивных химикатов, пока пол полностью не затвердеет, см. График отверждения.Дайте полу полностью высохнуть во время отверждения.

ОГРАНИЧЕНИЯ : Ограничьте использование пола легким движением и не агрессивными химикатами, пока пол полностью не затвердеет, см. График отверждения. Дайте полу полностью высохнуть во время отверждения.

ОГРАНИЧЕНИЯ:
  • На цвета или глянец могут повлиять высокая влажность, низкие температуры, химическое воздействие или воздействие освещения, например натриевых ламп.
  • Для достижения наилучших результатов используйте валик с ворсом 3/8 дюйма
  • Плита на уровне требует наличия гидроизоляции
  • Температура основания должна быть на 5 ° F выше точки росы
  • Весь новый бетон должен выдерживаться не менее 30 дней
  • Физические свойства являются типичными значениями, а не спецификациями
  • Продукт желтеет в присутствии УФ-излучения
  • Неправильное смешивание или слишком толстый слой нанесения могут привести к поломке продукта
  • Цвета могут отличаться от партии к партии, поэтому для всего задания используйте только продукты из одной партии.

УВЕДОМЛЕНИЕ ДЛЯ ПОКУПАТЕЛЯ: ОТКАЗ ОТ ГАРАНТИЙ И ОГРАНИЧЕНИЙ НАШЕЙ ОТВЕТСТВЕННОСТИ Floorguard Products® гарантирует, что наши продукты производятся в строгом соответствии со спецификациями обеспечения качества и что предоставленная нами информация является точной, насколько нам известно. Такая информация о наших продуктах не является представлением или гарантией. Он предоставляется при условии, что вы проведете собственные испытания, чтобы определить пригодность нашего продукта для вашей конкретной цели.Перечисленные физические свойства являются типичными и не должны рассматриваться как спецификации. НИКАКИХ ГАРАНТИЙ НЕ ПРЕДОСТАВЛЯЕТСЯ, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ В ОТНОШЕНИИ ДРУГИХ ИНФОРМАЦИЙ, ДАННЫХ, НА КОТОРЫХ ЕГО ОСНОВАНА, ИЛИ РЕЗУЛЬТАТОВ, КОТОРЫЕ ВЫ ПОЛУЧИТЕ В РЕЗУЛЬТАТЕ ЕГО ИСПОЛЬЗОВАНИЯ. НИКАКИХ ГАРАНТИЙ НЕ ПРЕДОСТАВЛЯЕТСЯ, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ, ЧТО НАШ ПРОДУКТ ДОЛЖЕН БЫТЬ ПРЕДНАЗНАЧЕН ДЛЯ ПРОДАЖИ ИЛИ ПРИГОДНОСТЬ НАШЕГО ПРОДУКТА ДЛЯ ЛЮБЫХ КОНКРЕТНЫХ ЦЕЛЕЙ. НЕ ДАЕТСЯ ГАРАНТИИ, ЧТО ИСПОЛЬЗОВАНИЕ ТАКОЙ ИНФОРМАЦИИ ИЛИ НАШЕГО ПРОДУКТА НЕ ЯВЛЯЕТСЯ НАРУШЕНИЕМ НИКАКИХ ПАТЕНТОВ. Мы не несем ответственности за случайные или косвенные убытки, прямые или косвенные.Наша ответственность ограничивается чистой продажной ценой нашего продукта или заменой нашего продукта, по нашему выбору. Принятие доставки нашего продукта означает, что вы принимаете условия этой гарантии, независимо от того, содержат ли заказы на покупку или другие документы условия, которые отличаются от данной гарантии. Ни один представитель не уполномочен делать какие-либо заявления, давать гарантии или брать на себя какие-либо другие обязательства от нашего имени при продаже наших продуктов. Наши продукты содержат химические вещества, которые могут вызвать СЕРЬЕЗНЫЕ ФИЗИЧЕСКИЕ ТРАВМЫ.ПЕРЕД ИСПОЛЬЗОВАНИЕМ ПРОЧИТАЙТЕ ПАСПОРТ БЕЗОПАСНОСТИ МАТЕРИАЛА И СОБЛЮДАЙТЕ ВСЕ МЕРЫ ПРЕДОСТОРОЖНОСТИ, ЧТОБЫ ПРЕДОТВРАТИТЬ ВРЕД ДЛЯ ТЕЛА.

Страница не найдена — LS-DYNA

Положения и условия

Условия использования пробных версий

Содержание

Это юридическое лицензионное соглашение («Соглашение») между вами («Пользователь») и Oasys Ltd («Oasys»). Пожалуйста, внимательно прочтите условия настоящего Соглашения перед загрузкой, установкой или использованием любого программного обеспечения, упомянутого в нем.

Нажимая «Принять условия и положения» ниже, предоставляя Oasys контактные данные пользователя с целью загрузки / использования Программного обеспечения или загрузки, установки или использования Программного обеспечения, Пользователь подтверждает и соглашается с тем, что:

  • Пользователь использует Программное обеспечение исключительно на свой страх и риск;
  • Программное обеспечение предоставляется по лицензии, а не продается Пользователю, и Пользователь может использовать Программное обеспечение только в соответствии с настоящим Соглашением; и
  • , как описано далее в данном Соглашении, Программное обеспечение предоставляется «как есть».

Если Пользователь не согласен с условиями настоящего Соглашения, он не может загружать, устанавливать или использовать Программное обеспечение.

ПРЕДОСТАВЛЕНИЕ ЛИЦЕНЗИИ: Oasys предоставляет пользователю право на бесплатное использование копии Программного обеспечения Oasys Suite / программного обеспечения LS-DYNA / программного обеспечения FEMZIP / модели Barrier FE / модели Pedestrian FE и сопутствующей документации (совместно именуемые «Программное обеспечение» ) только в целях оценки и демонстрации на срок действия настоящего Соглашения.Если иное не согласовано в письменной форме, срок действия настоящего Соглашения составляет 1 месяц с даты загрузки Программного обеспечения Пользователем. Пользователь не имеет права распространять, раскрывать, продавать, сдавать в аренду или передавать Программное обеспечение третьим лицам. Oasys оставляет за собой все права на Программное обеспечение, не предоставленные Пользователю явным образом в настоящем Соглашении.

СРОК И ПРЕКРАЩЕНИЕ: Оценка Программного обеспечения начинается с даты загрузки Программного обеспечения Пользователем и прекращается по истечении срока действия настоящего Соглашения, как указано выше (именуемого «Сроком пробной лицензии»).Если Пользователь не приобретет Программное обеспечение до истечения Срока пробной лицензии, настоящее Соглашение автоматически истекает, и Пользователь должен немедленно уничтожить все копии Программного обеспечения, включая все носители и руководства, полученные с пробной копией. ПОЖАЛУЙСТА, ОБРАТИТЕ ВНИМАНИЕ: если Пользователь после этого лицензирует Программное обеспечение, все положения и условия Лицензионного соглашения по программному обеспечению Oasys, которое должно быть отдельно согласовано между Oasys и Пользователем до получения Пользователем Программного обеспечения, будут иметь полную силу и действие, а условия и условия настоящего Соглашения не имеют юридической силы.

АВТОРСКОЕ ПРАВО И КОНФИДЕНЦИАЛЬНОСТЬ: Пользователь понимает, что Программное обеспечение / Модели FE остаются собственностью авторов Программного обеспечения / Модели FE и защищены законами Соединенного Королевства об авторском праве и положениями международных договоров. Пользователь соглашается защищать Программное обеспечение / Модели FE, используя, по крайней мере, те же стандарты заботы и процедур, которые Пользователь использует для защиты своей собственной информации, и ни в коем случае не менее разумных стандартов заботы.

КОНТРОЛЬ ЭКСПОРТА: Пользователь понимает и признает, что Программное обеспечение / Модели FE подпадает под действие правил экспортного администрирования Великобритании. Если иное не согласовано в письменной форме, Пользователь не имеет права передавать Программное обеспечение за пределы Соединенного Королевства.

ГАРАНТИЯ: Oasys гарантирует, что Livermore Software Technology Corporation (LSTC) является владельцем программного обеспечения LS-DYNA, а Oasys Ltd — владельцем программного пакета Oasys Suite of Software и моделей FE. Oasys Ltd будет освобождать и защищать Пользователя от любых претензий, что Программное обеспечение нарушает какой-либо патент или авторское право США или нарушает любые другие права собственности третьих лиц.

ОТСУТСТВИЕ ДРУГИХ ГАРАНТИЙ: Пользователь признает, что эта лицензия предназначена только для ознакомительных целей и что Модели Программного обеспечения / FE предоставляются пользователю «как есть». OASYS ОТКАЗЫВАЕТСЯ ОТ ВСЕХ ГАРАНТИЙ, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ, ВКЛЮЧАЯ НО НЕ ОГРАНИЧИВАЮЩИЕСЯ ГАРАНТИЯМИ, КОММЕРЧЕСКОЙ ЦЕННОСТЬЮ И ПРИГОДНОСТЬЮ ДЛЯ КОНКРЕТНОЙ ЦЕЛИ. OASYS НЕ ГАРАНТИРУЕТ, ЧТО ПРОГРАММНОЕ ОБЕСПЕЧЕНИЕ СООТВЕТСТВУЕТ ТРЕБОВАНИЯМ ПОЛЬЗОВАТЕЛЯ, РАБОТАЕТ В КОМБИНАЦИЯХ, ВЫБРАННЫХ ПОЛЬЗОВАТЕЛЕМ, ОБЕСПЕЧИВАЕТ РЕЗУЛЬТАТЫ, ЖЕЛАЕМЫЕ ПОЛЬЗОВАТЕЛЕМ, ИЛИ РАБОТАЕТ БЕЗ ПЕРЕРЫВОВ ИЛИ БЕЗ ОШИБОК.

ОГРАНИЧЕНИЕ ОТВЕТСТВЕННОСТИ: OASYS НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ЗА ЛЮБЫЕ УБЫТКИ ИЛИ УЩЕРБ, КОТОРЫЕ МОГУТ ВОЗНИКНОВИТЬСЯ В СВЯЗИ С ОБОРУДОВАНИЕМ, РАБОТОЙ ИЛИ ИСПОЛЬЗОВАНИЕМ ПОЛЬЗОВАТЕЛЯ ПРОГРАММНОГО ОБЕСПЕЧЕНИЯ, ВКЛЮЧАЯ, БЕЗ ОГРАНИЧЕНИЙ, ЛЮБЫЕ ПРЯМЫЕ, КОСВЕННЫЕ, НЕПОСРЕДСТВЕННЫЕ, НЕПРАВИЛЬНЫЕ СВОЕГО РОДА.

ИЗМЕНЕНИЕ: Oasys оставляет за собой право изменять и / или изменять любые положения и условия настоящего Соглашения в любое время и без предварительного уведомления. Если Oasys внесет существенные изменения в настоящее Соглашение, она приложит разумные усилия, чтобы уведомить Пользователя об изменении.Например, Oasys может отправить сообщение на адрес электронной почты Пользователя или создать всплывающее или подобное уведомление, когда Пользователь впервые обращается к Программному обеспечению после внесения таких существенных изменений. Продолжая использовать Программное обеспечение после того, как Oasys опубликовала изменение настоящего Соглашения, Пользователь соглашается соблюдать измененное Соглашение. Если измененное Соглашение неприемлемо для Пользователя, единственный выход для Пользователя — прекратить использование и удалить Программное обеспечение. Настоящее Соглашение также будет регулировать любые обновления программного обеспечения и / или обновления, предоставляемые Oasys, которые обновляют и / или дополняют Программное обеспечение, если такие обновления и / или обновления не сопровождаются отдельной лицензией, и в этом случае будут применяться условия этой отдельной лицензии.

ПОЛНОЕ СОГЛАШЕНИЕ: Настоящее Соглашение устанавливает полное соглашение и понимание сторон и заменяет собой все предыдущие устные и письменные соглашения и договоренности, относящиеся к ним. Настоящее Соглашение вступает в силу только в том случае, если Пользователь выражает согласие с его условиями любым из способов, описанных выше. Настоящее Соглашение регулируется английским законодательством, и любые споры передаются в английские суды.

15 лучших секс-поз для глубокого проникновения

Смотреть друг другу в глаза и синхронизировать дыхание для глубокого страстного секса может быть довольно умопомрачительным.Но что, если вы ищете буквально , углубитесь? Вы знаете, как в исследованиях космоса ни пенис, ни фаллоимитатор, ни страпон еще не использовались в сексуальных позах, разработанных для глубокого проникновения? Ну, это тоже чертовски жарко.

«Более глубокое проникновение может обеспечить мультисенсорную стимуляцию различных эрогенных зон на теле, включая большее трение по клитору, стимуляцию точки G и точки А и даже стимуляцию шейки матки», — говорит Шеннон Чавес, PsyD, a лицензированный психолог и сексопатолог KY.Но тип секса, к которому вы привыкли, и ваша реальная анатомия играют роль в том, насколько вам доставляет удовольствие глубокое проникновение, — говорит она.

Если вы не занимаетесь сексом позы для глубокого проникновения на рег, вы можете подумать о том, чтобы сделать несколько шагов, чтобы чувствовать себя максимально комфортно, когда вы их попробуете, говорит Чавес. Она также рекомендует использовать «адекватную смазку», которая поможет вам погрузиться в процесс и почувствовать себя комфортно в процессе.

Имейте в виду, что глубокое проникновение не для всех.«Различные типы анатомии могут сделать более глубокое проникновение болезненным», — говорит Чавес. «У некоторых женщин перевернутая матка или шейка матки могут вызывать некоторый дискомфорт при проникновении. Другие женщины могут испытывать такие состояния, как эндометриоз или хроническая тазовая боль, которые могут вызывать боль из-за воспаления и стеснения в мышцах тазового дна ».

И для некоторых женщин более глубокое проникновение не обеспечивает такой сильной стимуляции, как другие позы, говорит Чавес. Для других это потрясающе.

Некоторые позы для секса (и некоторые люди) просто лучше подходят для серьезного проникновения.Если это похоже на вас, попробуйте эти горячие движения, когда вы настроены на что-то более интенсивное.

Этот контент импортирован из {embed-name}. Вы можете найти тот же контент в другом формате или найти дополнительную информацию на их веб-сайте.

Утюг

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Поднятые бедра создают низкий барьер для входа, говорит сексопатолог из Нью-Йорка Иэн Кернер, доктор философии, автор книги She Comes First. Плюс, этот дает отличную стимуляцию точки G. «Вы можете оживить это еще больше, поделившись своими фантазиями, пока вы заняты», — говорит Чавес.

➡ Присоединяйтесь к WH Stronger сегодня и получите неограниченный доступ к цифровому контенту, эксклюзивным тренировкам и многому другому!

Сделайте это: Лягте лицом вниз, слегка приподняв бедра (попробуйте подложить под них подушку), и вытяните ноги прямо. Пусть ваш партнер проникает в вас сзади.

Вбрасывание

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Поскольку ноги здесь шире, вы более открыты для получения из всех , которые может предложить ваш партнер, — говорит Кернер. Это также замечательно, потому что вы можете контролировать темп и насколько глубоко вы хотите, чтобы пенис или страпон вашего партнера вошел. Кроме того, в этой позе ваши руки будут свободны, и вы сможете свободно перемещаться по телу партнера (или по вашему собственному). Добавьте сюда много глубоких поцелуев.«Глубокий поцелуй может быть очень приятным и возбуждающим, что может помочь телу расслабиться и снять напряжение в области таза, чтобы более глубокое проникновение было более комфортным», — говорит Чавес.

Сделай это : Пока ваш партнер сидит на стуле или краю кровати, вы сидите ему на коленях лицом к нему.

Наездница

ЭМИЛИ ШИФФ-СЛЕЙТЕР

В этом положении, говорит Кернер, вы можете шире раздвинуть ноги для более глубокого ощущения.Этот прием также обеспечивает достаточное действие точки G (точка на передней стенке влагалища). По словам Чавеса, вы также можете стимулировать соски во время езды для дополнительного удовольствия.

Сделайте это: Пусть ваш партнер ляжет, а вы заберетесь на вершину. Оттолкнитесь от груди партнера или от кровати, чтобы контролировать свои движения.

Помощник наездницы

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Это дает вам отличную стимуляцию точки G, и вы можете погружаться настолько глубоко, насколько захотите, в зависимости от ваших толчков, — говорит Кернер.Кроме того, у вас есть шанс доминировать. Поскольку вы оба довольно активны в этой позе, попробуйте немного грязно поговорить, чтобы было еще жарче.

Сделайте это: Как и в классической позе наездницы, вы находитесь сверху, когда ваш партнер лежит на спине, и вы отталкиваетесь от его тела, чтобы получить рычаг. Дело в том, что ваш партнер помогает. Удерживая ваши бедра или бедра, он поддерживает ваш вес и поднимается, чтобы соответствовать вашим движениям.

Миссионерская позиция

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Это классика не зря — она ​​дает вам глубокую стимуляцию в сочетании с интимностью, — говорит Кернер.(Привет, лучшая поза для поцелуев!) Чтобы перейти на следующий уровень, поднимите ноги над плечами партнера. Попробуйте добавить глубокие поцелуи для максимальной близости.

Сделай это : Лягте, пока ваш партнер лежит на вас, лицом к лицу.

Собачка

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Угол этого положения обеспечивает глубокое проникновение благодаря наклону вниз (и это отлично подходит для некоторой стимуляции точки G), — говорит Кернер.Кроме того, по словам Чавеса, руки вашего партнера могут стимулировать ваш клитор или немного поиграть сосками.

Сделайте это: Встаньте на четвереньки, пока ваш партнер становится на колени прямо позади вас и входит в вас сзади.

Камбуз

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Поскольку это, вероятно, не ваша основная должность, там внизу вы почувствуете себя совершенно новым миром, — говорит Кернер. Эта новизна может сделать проникновение еще глубже, чем оно есть на самом деле.Кроме того, отсутствие возможности видеть своего партнера может быть невероятно сексуальным, поскольку вы не знаете, чем он вас удивит в следующий раз. Вы также можете использовать внешний вибратор, чтобы «подготовить тело для более комфортного и приятного секса», — говорит Чавес.

Сделай это : Ваш партнер сидит, а вы возвращаетесь ему на колени, лицом в сторону.

Зачерпните меня

ЭМИЛИ ШИФФ-СЛЕЙТЕР

У вашего партнера больше рычагов и поддержки в этой позе, поэтому он может двигать своим телом так, чтобы обеспечить максимальную глубину, — говорит Кернер.К тому же, по словам Чавеса, ваш партнер может легко обхватить рукой ваш клитор и стимулировать ваш клитор. «Стимуляция клитора в дополнение к более глубокому проникновению обеспечивает различные точки стимуляции и возбуждения для увеличения потенциала удовольствия», — добавляет она. Этот также идеально подходит, когда вы оба устали, но все еще в хорошем настроении.

Сделай это : Лягте бок о бок в позу ложки и слегка согните колени, чтобы партнер мог войти в вас сзади.

Морская ракушка

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Ваши ноги широко расставлены, что делает движение еще более глубоким, — говорит Кернер.Кроме того, из этой позиции таз вашего партнера будет стимулировать клитор, когда ваш партнер будет упираться в вас — или вы можете взять это в свои руки. По словам Чавеса, глубокие поцелуи также могут поднять настроение.

Сделай это : Лягте на спину с поднятыми вверх ногами. Отведите лодыжки как можно дальше назад к голове. Затем ваш партнер входит в вас в миссионерском стиле.

Ом

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Эта поза предназначена для того, чтобы раскрыть себя — особенно ноги и бедра, — говорит Кернер.Здесь вы можете погрузиться в нечто большее, чем один: смотреть в глаза партнеру во время кульминации для дополнительной близости, — говорит Кернер. По словам Чавеса, попробуйте немного поцеловаться или поиграть сосками, чтобы сделать вещи еще более интенсивными.

Сделай это: Ваш партнер сидит, скрестив ноги, затем вы садитесь ему на колени лицом вперед. Затем оберните ноги вокруг спины партнера, подтяните друг друга ближе и раскачивайтесь взад и вперед.

Соус для кренделя

ЭМИЛИ ШИФФ-СЛЕЙТЕР

С этой позой для секса вы получаете как физическую, так и эмоциональную глубину.У вас более глубокое проникновение в собачий стиль, но при этом вы можете смотреть в глаза. Бонус: эта позиция удобна для дополнительных действий вашего партнера с клитором, что, по словам Чавеса, всегда является преимуществом.

Сделайте это: Лягте на правый бок; ваш партнер становится на колени, садится на вашу правую ногу и обхватывает левую ногу вокруг своего левого бока.

Чехия

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Подобно утюгу, приподнятые бедра в этом положении обеспечивают сверхглубокое проникновение.И если вы добавите подушку под таз, это действительно поможет вашему партнеру нацелить эту точку G (и дать вашей спине отдохнуть). Вы можете попросить партнера дотянуться до вашего клитора, пока он толкает его, или сделайте это самостоятельно, как вам нравится.

Сделай это: Встань на четвереньки; держа бедра поднятыми, положите голову и руки на кровать. Пусть ваш партнер войдет в вас сзади.

Артист балета

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Чтобы сделать эту позу действительно выдающейся для глубокого проникновения, попробуйте положить поднятую ногу через плечо партнера, чтобы открыть более широкую ногу.Если для этого требуется слишком большая гибкость, эта позиция лицом к лицу все равно будет отличным вариантом. По словам Чавеса, добавьте глубокие поцелуи, чтобы получить супер интимные отношения.

Сделай это : Встаньте на одну ногу, встаньте лицом к партнеру и оберните другую ногу вокруг его талии, пока он поддерживает вас.

Тачка

ЭМИЛИ ШИФФ-СЛЕЙТЕР

Когда ваши ноги буквально зажаты вокруг бедер партнера, а ваше тело наклонено вниз, это создает отличную ситуацию глубокого проникновения.Не говоря уже о том, что это серьезная тренировка рук. Вы оба будете очень заняты на этой должности, но Чавес говорит, что вы можете немного поговорить о фантазиях, чтобы сделать ее еще сексуальнее. И всякий раз, когда вы хотите дать рукам отдохнуть, измените положение рук и положите их на стол или край кровати.

Сделай это : Встаньте на руки и ноги, и пусть ваш партнер поднимет вас за таз. Затем обхватите их талию бедрами.

Мастер пинбола

ЭМИЛИ ШИФФ-СЛЕЙТЕР

В этом положении ваши ноги широко расставлены, что дает возможность делать глубокие толчки, — говорит Кернер.Вы также можете попробовать закинуть одну ногу на плечо партнера для еще более глубокого проникновения. Или, если у вас хороший баланс, говорит Чавес, вы можете одной рукой стимулировать соски или клитор.

Сделай это : Примите положение частичного моста, положив вес на плечи. Ваш партнер входит в вас, стоя на коленях.

Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты.Вы можете найти больше информации об этом и подобном контенте на сайте piano.io.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *