Нужно ли разбавлять грунтовку водой: Как применять грунтовку грубокого проникновения

Содержание

Как применять грунтовку грубокого проникновения

Содержание статьи:

Многие виды строительно-отделочных работ выполняются только после применения грунтовки глубокого проникновения. Она является связующим слоем, снижает впитываемость обрабатываемого материала, а также придаёт некоторым из них особенные качества — устойчивость к влаге, плесени.

Грунт относится к строительной химии и служит для подготовки плоскости под последующую отделку. Краска, обои, шпатлёвка, штукатурка, стяжка и другие строительно-отделочные материалы гораздо лучше держатся на поверхности, если она подготовлена с применением пропитывающей грунтовки. Познакомимся с ней поближе.

Состав грунтовки глубокого проникновения

Грунт – это эмульсия, то есть взвесь полимерной смолы (чаще всего акрилового типа) в воде с добавлением смягчающих и разжижающих веществ.

Показатели смачиваемости и капилярного проникновения грунтовки выше, чем, например, воды из крана, поэтому она легко и глубоко проникает в пористые и рыхлые материалы, заполняет пространство между их твёрдыми частичками.

После испарения воды она полимеризуется, обволакивая и склеивая частички, а значит дополнительно цементируя структуру материала.

Подбирайте грунтовку только для того основания на которое она будет наноситься и для того покрытия, которое будет наносится на грунтованную поверхность. Идеально вариант — использование ґрунтовки одной торговой марки с материалом последующего слоя.

Функции и характеристика грунтовок

Грунтовка глубоко проникает в цементно-известковое или бетонное основание и, полимеризуясь внутри, связывает его частички и укрепляет структуру. Образуется скреплённый монолит, воздухо- и паропроницаемый, более устойчивый к воздействию влаги, физическому воздействию (вибрация, удары, трение) и изменению температур.

Грунтование улучшает адгезию основания, то есть его способность принимать, удерживать и схватываться с отделочными материалами органического происхождения (клей, краска) или строительными смесями с органическими добавками (самонивелир, штукатурка, шпатлёвка).

Само основание имеет, как правило, неорганический характер (песок, известь, цемент) или органический (дерево, ДВП, ДСП, бумага), но не родственный полимерам, применённым в отделочных составах.

Укрепляющая грунтовка глубокого проникновения углубляется в обрабатываемую поверхность, склеивает её частички и волокна, обволакивает их полимерной плёнкой, с которой в последствие и схватывается родственный полимер из наносимого раствора.

Обработанная плоскость плавно (равномернее и дольше) отнимает влагу из наносимого раствора, что позволяет избежать возникновения внутренних напряжений как в структуре самого раствора (штукатурки, шпаклёвки, краски, клея) так и в плоскости соприкосновения раствора и основания.

Соответственно, грунтование страхует от чрезмерной усадки, растрескивания и отслоения раствора после высыхания и в процессе дальнейшей эксплуатации.

Применение грунтовки глубокого проникновения

  • Подготовка цементно-известковых и бетонных оснований к шпаклеванию или заштукатуриванию.
  • Подготовка оштукатуренных и зашпаклёванных поверхностей к покраске, нанесению побелки, оклейке обоями, пенополистирольными плитами, панелями, керамической плиткой и так далее.
  • Подготовка бетонного пола к использованию стяжки, самонивелирующегося раствора или ремонтной шпаклёвки.
  • Подготовка бетонного пола к укладке линолеума, коврового покрытия, керамической плитки.
  • Подготовка ДВП, ДСП, гипсокартона, дерева к шпаклеванию, покраске или оклейке обоями.
  • Пропитывание зафугованных швов между керамическими плитками для защиты фуги от вымывания водой.
  • Пропитывание поверхностей антисептической грунтовкой глубокого проникновения для профилактики появления плесени и грибков гниения.
  • Праймирование, то есть приготовление мальмы «молочка» путём добавления в грунтовку небольшого количества сухой строительной смеси и применение этого раствора за 20-30 минут до нанесения самонивелира, штукатурки. Данная операция используется для исключения внутренних напряжений в плоскости соприкосновения высыхающей строительной смеси и гигроскопичного пористого основания.

Можно ли разбавлять грунтовку водой

Грунтовку глубокого проникновения можно разбавлять водой только в пределах 10% от общего объёма. Больше 10% нельзя ни в коем случае, так как она начинает терять свои основные свойства. Смысл в её использование в разбавленном виде пропадает вообще. Исключение составляет лишь концентрированная грунтовка. Её разводить необходимо в пропорциях, указанных в инструкции по применению.

Главное правило при покупке и дальнейшем использовании — читайте внимательно инструкцию по применению и чётко ей следуйте. Каждый производитель указывает на упаковке правила разбавления грунтовки.

Можно ли грунтовать разбавленной пожиже краской

Мой ответ нет, так как ни одна из трёх целей грунтования не будет достигнута при помощи разбавленной пожиже краски:

  • не будет структурного укрепления основания, так как краска не проникнет глубоко;
  • не будет улучшения адгезии, так как слой или плёнка краски сама не надёжно держится за непрогрунтованное основание;
  • не будет нивелирования внутренних напряжений при нанесении последующих слоёв отделки, так как тонкая плёнка высохшей краски не сдержит резкий отход влаги из наносимых растворов в гигроскопичное основание.

Кроме того, большинство красок уже разбавлены до рабочей вязкости на заводе и дальнейшее разведение может привести к дестабилизации дисперсии — превратится в побелку, которая мажется. Поэтому грунтовать разбавленной пожиже краской нельзя!

Обязательно применяйте для этих целей пропиточную грунтовку. Соблюдайте все технологические процессы и мои рекомендации описанные на сайте, и тогда у Вас получится идеальный ремонт своими руками!

Нужно ли грунтовку разбавлять водой


Как правильно грунтовать стены?

От того, насколько будет ровной базовая поверхность, зависит качество оклейки обоями, покраска или наложение декоративной штукатурки.

Но чтобы именно так и получилось, необходимо в точности соблюдать технологию отделочных работ, хотя многие начинающие почему-то забывают о таком этапе как грунтовка.

Как наносить грунтовку на стены?

Грунтовка представляет собой клеящий раствор и предназначена для скрепления поверхности базового покрытия, перед нанесением на него клеевых составов.

Верное подтверждение того, что стена готова под чистовые работы – это отсутствие опадания каких-либо фракций с нее, при проведении каким-нибудь твердым предметом по поверхности штукатурки, в противном случае, проводить чистовые отделочные работы нельзя. Грунтовка выполняется перед:

  • Оштукатуриванием цементно-песчаной смесью;
  • Стартовой шпаклевкой;
  • Оклейкой обоями.

Таким образом, процесс грунтования будет проводиться три раза, причем каждый раз в два слоя, но при этом можно использовать один и тот же инструмент.

Для грунтования на открытых участках применяют валик, а в углах пользуются квадратной кистью, сперва необходимо обработать именно эти места, обильно пройдясь по стыкам ворсом кисти, зато в последующие разы этого можно не делать.

Грунтовочный раствор необходимо налить в пластиковый поддон и периодически смачивать в нем валик, перед раскатыванием по стене, с валика надо удалить излишки жидкости, поскольку она имеет низкую плотность и при избытке станет стекать с ворса.

После высыхания первого слоя, аналогично выполняют второй.

Как разводить грунтовку для стен?

Надо сказать, что грунтовка хотя и не самая дорогая составляющая ремонта, однако, при отделке большой площади ее понадобится достаточно много, особенно подготавливая оштукатуренную поверхность под шпаклевку, как известно, цементно-песчаная смесь прекрасно впитывает влагу.

Именно поэтому многие и даже опытные штукатуры практикуют разбавление раствора водой, но в каких случаях это можно делать и каким способом?

Если грунтовка концентрированная, что делается для удобства транспортировки, то разбавлять ее не только можно, но и нужно, делается это в пропорции указанной на упаковке. Для обычной грунтовки все зависит от производителя и обрабатываемой поверхности.

Рекомендуется пропорция – на две части грунта одна часть воды, но необходимое условие – раствор должен быть использован сейчас же и весь, так как к следующему дню его качества значительно ухудшатся.

Разбавлять можно грунт наносимый на бетонную стену под штукатурку или на шпаклевку под обои, а вот на штукатурку под шпаклевку не рекомендуется, так как цементно-песчаная смесь достаточно хорошо впитывает влагу, а от слабого содержания связующих, она может начать отслаиваться.

Чем заменить грунтовку для стен?

Иногда по каким-то причинам, грунтовки не хватает, а если остается обработать небольшой участок поверхности, то посещение магазина нецелесообразно и в таком случае на помощь могут придти различные способы замены грунтующего состава.

Основное предназначение грунтовки, это скрепление поверхности, чтобы она не «сыпалась», значит и замещающее средство должно обладать похожими свойствами. Необходимо иметь ввиду, что ни один заменитель не будет лучше и дешевле грунтовки, поэтому лучше все-таки найти возможность приобрести этот материал.

В качестве заменителя можно использовать разбавленный клей ПВА или водно-дисперсионную краску, а единственным фабричным заменителем можно считать шпатлевку, которая укладывается на штукатурку без грунтовки.

Также вам будет полезно:

Но стоить такое решение будет естественно дороже, хотя если необходимо сэкономить время, то это самый оптимальный вариант.

Также вам будет интересно видео о том, как правильно грунтовать стены

Твитнуть

postroyka.org

Правильное нанесение грунтовки на стены: нужно ли разводить водой, каким валиком лучше грунтовать, нужно перед грунтовкой мыть стены

Скромная снаружи, но такая важная внутри. Речь о грунтовочной смеси и ее мощных функциях. Благодаря ей настенные и потолочные покрытия отлично держатся и прекрасно смотрятся.

Грунтовка — залог красивой поверхности и качественного ремонта

Ремонт требует основательного подхода, физических усилий и финансовых затрат.

Чтобы результат радовал своих хозяев долго, важно ничего не упустить.

Привести стены и потолки в достойный вид без грунтовочной пропитки не выйдет.

Что такое грунтовка

Это строительный состав в виде жидкости, которым обрабатывают стены, полы, потолки. Выполняет следующие задачи:

  • усиливает адгезию — сцепление разнородных материалов, в данном случае между
  • обрабатываемой поверхностью и отделкой;
  • укрепляет основание;
  • выравнивает слой;
  • защищает от коррозии;
  • экономит расход краски.

Состав смеси зависит от ее прямого назначения и типа поверхности. Накладывается она на:

  • бетон;
  • кирпич;
  • дерево;
  • гипсокартон;
  • старую краску.

Когда применяется огрунтовка

Процесс огрунтовки происходит перед:

  • поклейкой обоев;
  • укладкой кафельной плитки;
  • нанесением побелки/свежей краски, для наилучшего скрепления отделочных
  • материалов с основанием.

Вначале обрабатываемые места нужно отштукатурить и выровнять шпаклевкой, затем дать им полностью высохнуть.

Только после этих операций возможно нанесение грунтовочного покрытия.

Как правильно нанести грунтовку на стены и потолок, как правильно грунтовать

Чтобы итоговое покрытие настенными и потолочными материалами выглядело как нельзя лучше, следует придерживаться нескольких пунктов и рекомендаций.

Нужно ли разводить с водой

Если речь идёт о готовой смеси — ее достаточно хорошенько размешать. Концентрат же требует добавления воды. Отношение грунтовой пропитки к воде: два к одному, но обычно производитель уточняет об этом на упаковке индивидуально для своего продукта.

Какой лучше валик выбрать

В магазине представлен широкий ассортимент валиков. Практический опыт показывает, какими из них работать лучше и удобнее в той или иной ситуации.

Валик состоит из рукоятки с держателем и ролика. Рукоятку принято выбирать прочную, чтобы инструмент прослужил долгие годы. Ролик с «шубкой» из поролона, меха, велюра со временем изнашивается и требует замены.

Поролоновый применяют для нанесения смеси густой консистенции. Меховой считается универсальным, он подходит как для густой, так и для жидкой смеси. Желательная длина ворса — 15 мм.

Велюровый также справляется с жидкими и густыми составами. Ворс такого типа валика не превышает 5 мм, поэтому им следует грунтовать исключительно гладкие поверхности.

Каким валиком лучше быстрее грунтовать

Для ускоренного темпа работы стоит воспользоваться меховым валиком и удлинителем рукоятки с телескопической конструкцией.

Нужно ли мыть стены

Перед непосредственным нанесением грунтовочного покрытия следует убедиться, что обрабатываемое место очищено от грязи и пыли. Достаточно пройтись по нему простым шпателем, а затем влажной губкой.

Сколько слоев нужно нанести

Количество наносимых слоев зависит от степени неровностей стен и потолков. Мастера рекомендуют грунтовать в два слоя для достижения качественного результата. Причем после каждого слоя обязательно дать покрытию высохнуть.

Нанесение

Для начала требуется правильно определиться с выбором грунтовочной смеси. Он зависит от:

  • гладкости/пористости поверхности;
  • типа финишного отделочного материала.

Совершенно неважно — стены или потолок необходимо пропитать, в этом плане разделения нет.

Процесс работы нельзя назвать сложным. Для удобства и наилучшего результата необходимо воспользоваться специальным лотком — малярной ванночкой, куда следует перелить часть строительной пропитки. Валик, смоченный в составе, раскатывается по ванночке, отжимая излишки. Это обязательное условие, чтобы во время обработки жидкая смесь не стекала с поверхности.

Вначале следует пропитать углы и примыкания, далее — основные поверхности.

Популярные грунтовки

Грунтовочная смесь подразделяется на 3 типа:

  • краска;
  • средство глубокого проникновения;
  • бетон-контакт.

Краска используется на гладком и ровном основании. Для пористых, шероховатых и хорошо впитываемых влагу мест применяют покрытия глубокого проникновения. Бетон-контакт наносится под декоративную штукатурку.

Для бетона, кирпича, гипсокартона и камня подойдёт акриловая грунтовочная пропитка. Для деревянных и металлических оснований — алкидная. Силикатной обрабатывают кирпич и наружную штукатурку.

Лидерами продаж являются Ceresit CT 17, Tiefgrund LF D 14, Bindo Base, Acton, Opti Grund E. L.F.

Когда можно проводить покраску, поклейку

После нанесения состава, стены и потолок должны полностью просохнуть. В этот промежуток нужно приостановить все ремонтные работы, чтобы поверхность оставалась чистой. Время высыхания зависит от типа основания, влажности и температуры помещения, иногда на это уходит 4 часа, а иногда целые сутки. Если место, на которое нанесено средство, уже не прилипает к рукам — пора отделывать его облицовочными материалами.

Грунтовка необходима для качественного ремонта и долговечности результата. Пренебрежение этой процедурой приведет к дефектам и недостаткам поверхности, которые после окончательной отделки станут заметны невооруженным глазом. Помимо идеального внешнего вида стены и потолок усилят свои прочностные характеристики, на них не появится плесень.

Полезное видео

otdelkasten.com

Как применять грунтовку грубокого проникновения

Многие виды строительно-отделочных работ выполняются только после применения грунтовки глубокого проникновения. Она является связующим слоем, снижает впитываемость обрабатываемого материала, а также придаёт некоторым из них особенные качества — устойчивость к влаге, плесени.

Грунт относится к строительной химии и служит для подготовки плоскости под последующую отделку. Краска, обои, шпатлёвка, штукатурка, стяжка и другие строительно-отделочные материалы гораздо лучше держатся на поверхности, если она подготовлена с применением пропитывающей грунтовки. Познакомимся с ней поближе.

Состав грунтовки глубокого проникновения

Грунт – это эмульсия, то есть взвесь полимерной смолы (чаще всего акрилового типа) в воде с добавлением смягчающих и разжижающих веществ.

Показатели смачиваемости и капилярного проникновения грунтовки выше, чем, например, воды из крана, поэтому она легко и глубоко проникает в пористые и рыхлые материалы, заполняет пространство между их твёрдыми частичками. После испарения воды она полимеризуется, обволакивая и склеивая частички, а значит дополнительно цементируя структуру материала.

Подбирайте грунтовку только для того основания на которое она будет наноситься и для того покрытия, которое будет наносится на грунтованную поверхность. Идеально вариант — использование ґрунтовки одной торговой марки с материалом последующего слоя.

Функции и характеристика грунтовок

Грунтовка глубоко проникает в цементно-известковое или бетонное основание и, полимеризуясь внутри, связывает его частички и укрепляет структуру. Образуется скреплённый монолит, воздухо- и паропроницаемый, более устойчивый к воздействию влаги, физическому воздействию (вибрация, удары, трение) и изменению температур.

Грунтование улучшает адгезию основания, то есть его способность принимать, удерживать и схватываться с отделочными материалами органического происхождения (клей, краска) или строительными смесями с органическими добавками (самонивелир, штукатурка, шпатлёвка).

Само основание имеет, как правило, неорганический характер (песок, известь, цемент) или органический (дерево, ДВП, ДСП, бумага), но не родственный полимерам, применённым в отделочных составах.

Укрепляющая грунтовка глубокого проникновения углубляется в обрабатываемую поверхность, склеивает её частички и волокна, обволакивает их полимерной плёнкой, с которой в последствие и схватывается родственный полимер из наносимого раствора.

Обработанная плоскость плавно (равномернее и дольше) отнимает влагу из наносимого раствора, что позволяет избежать возникновения внутренних напряжений как в структуре самого раствора (штукатурки, шпаклёвки, краски, клея) так и в плоскости соприкосновения раствора и основания.

Соответственно, грунтование страхует от чрезмерной усадки, растрескивания и отслоения раствора после высыхания и в процессе дальнейшей эксплуатации.

Применение грунтовки глубокого проникновения

  • Подготовка цементно-известковых и бетонных оснований к шпаклеванию или заштукатуриванию.
  • Подготовка оштукатуренных и зашпаклёванных поверхностей к покраске, нанесению побелки, оклейке обоями, пенополистирольными плитами, панелями, керамической плиткой и так далее.
  • Подготовка бетонного пола к использованию стяжки, самонивелирующегося раствора или ремонтной шпаклёвки.
  • Подготовка бетонного пола к укладке линолеума, коврового покрытия, керамической плитки.
  • Подготовка ДВП, ДСП, гипсокартона, дерева к шпаклеванию, покраске или оклейке обоями.
  • Пропитывание зафугованных швов между керамическими плитками для защиты фуги от вымывания водой.
  • Пропитывание поверхностей антисептической грунтовкой глубокого проникновения для профилактики появления плесени и грибков гниения.
  • Праймирование, то есть приготовление мальмы «молочка» путём добавления в грунтовку небольшого количества сухой строительной смеси и применение этого раствора за 20-30 минут до нанесения самонивелира, штукатурки. Данная операция используется для исключения внутренних напряжений в плоскости соприкосновения высыхающей строительной смеси и гигроскопичного пористого основания.

Можно ли разбавлять грунтовку водой

Грунтовку глубокого проникновения можно разбавлять водой только в пределах 10% от общего объёма. Больше 10% нельзя ни в коем случае, так как она начинает терять свои основные свойства. Смысл в её использование в разбавленном виде пропадает вообще. Исключение составляет лишь концентрированная грунтовка. Её разводить необходимо в пропорциях, указанных в инструкции по применению.

Главное правило при покупке и дальнейшем использовании — читайте внимательно инструкцию по применению и чётко ей следуйте. Каждый производитель указывает на упаковке правила разбавления грунтовки.

Можно ли грунтовать разбавленной пожиже краской

Мой ответ нет, так как ни одна из трёх целей грунтования не будет достигнута при помощи разбавленной пожиже краски:

  • не будет структурного укрепления основания, так как краска не проникнет глубоко;
  • не будет улучшения адгезии, так как слой или плёнка краски сама не надёжно держится за непрогрунтованное основание;
  • не будет нивелирования внутренних напряжений при нанесении последующих слоёв отделки, так как тонкая плёнка высохшей краски не сдержит резкий отход влаги из наносимых растворов в гигроскопичное основание.

Кроме того, большинство красок уже разбавлены до рабочей вязкости на заводе и дальнейшее разведение может привести к дестабилизации дисперсии — превратится в побелку, которая мажется. Поэтому грунтовать разбавленной пожиже краской нельзя!

Обязательно применяйте для этих целей пропиточную грунтовку. Соблюдайте все технологические процессы и мои рекомендации описанные на сайте, и тогда у Вас получится идеальный ремонт своими руками!

babyremont.ru

Чем разбавить акриловый грунт – как разводить грунтовку?

Разбавляем смесь

Акриловые грунтовки представляют собой компонентные составы. От этого и зависит технология их разбавления. Для таких целей специалисты рекомендуют использовать несколько веществ:

  • Оптимальным разбавителем будет специальная акриловая смесь, которая совместима с той или иной маркой. Зачастую подобные растворы рекомендуют производители этой продукции.
  • Вода. Эту смесь можно использовать только в тех случаях, когда в состав грунта входит подобный компонент. Зачастую разбавляют смеси на водно-акриловой основе.

Некоторые пользователи рекомендуют применять специальный разбавитель 647. Но этот вопрос является спорным, так как использование этого продукта зависит от свойств выбранного грунта.

Количество разбавителя зачастую не превышает 25% от общего объема смеси. Обратите внимание, что важно здесь также учитывать количество отвердителя, который добавляется в раствор при смешивании.

Узнать точные пропорции и рекомендованный растворитель можно на упаковке. Важно соблюдать все основные рекомендации, чтобы получить качественную и долговечную защиту.

>Как разводить грунтовку для авто

Грунтовка автомобиля своими руками

Грунтовка автомобиля своими руками осуществляется значительно легче, чем покраска, ведь подтеки на грунте сделать достаточно трудно. Технология грунтовки простая, как советский автомобиль. Поэтому чтобы качественно загрунтовать машину самому, вам достаточно один раз прочитать не сложную технологию.

Грунтовку машины лучше всего проводить в относительно чистом, хорошо вентилируемом помещении, в котором будет минимум пыли. Если речь идет о локальной грунтовке, то следует укрыть детали, которые не будут грунтоваться, специальной бумагой (в крайнем случае газетами) и малярным скотчем. Перед нанесением грунта следует заранее приготовить такой инструмент, как грунтовочный пульверизатор.

Как правильно развести грунт?

После обклейки машины нужно развести грунт. Первым делом его нужно тщательно перемешать, чтобы поднять со дна банки необходимые компоненты. После чего развести с отвердителем (крайне желательно использовать только родной) и растворителем (желательно родной, но можно и 646). Пропорции должны быть указаны на банке. Лучше не разводить на глаз, а пользоваться специальной емкостью, где можно видеть граммы. Готовую смесь желательно отфильтровать через фирменный фильтр или обычную марлю (сложенную в 3-4 раза). Обычно грунт достаточно нанести в 2-3 слоя. Крайне важно придерживаться сушки между слоями в 5-10 минут. В противном случае грунт может кипеть.

Выбор цвета

Выбор цвета грунта имеет большое значение. Краска должна перекрывать грунт так, чтобы он не просвечивался под разными углами. Универсальным цветом является серый. Так же существуют грунтовки черного, белого и красного цвета. При помощи этой палитры можно смешивать грунты и получать желаемый цвет. Важно помнить, что смешиваемые материалы должны быть одной фирмы.

Грунтовка

Перед тем, как начать грунтовать, нужно обтереть машину антистатической салфеткой и затем обезжирить антисиликоном или спиртом. Теперь можно грунтовать. По технологии первый слой нужно нормально залить. Но, если грунтовка ложится на старое лакокрасочное покрытие, которое в некоторых местах протерто до старого грунта, то именно на этих местах может деформировать грунт (подорвать). Чтобы этого избежать, нужно первый слой напылить и подсушить минут 10. Второй и третий слой можно заливать. Затем дать высохнуть 24 часа.

Обработка

Обрабатывать грунт можно как на сухую, так и с водой. Здесь следует помнить, что грунты частично впитывают воду, что со временем приводит к коррозии металла. Поэтому, лучше обрабатывать на сухую. В этом хорошо может помочь специальная шлифовальная машинка. Под металик кузов следует зачищать наждаком Р-600 и Р-800. А вот под обычный акрил достаточно будет Р-400 и Р-500.

Как быть с новыми деталями?

Новым деталям нужно уделить дополнительное внимание, ведь их покрывают транспортировочным грунтом (как правило черным). Чтобы ремонт машины был качественным, транспортировочный грунт нужно счистить наждаком Р-240 до металла. После этой процедуры можно положить 2-3 слоя грунта. И через 10-15 минут проявить противоположным по цвету грунтом или краской. На следующий день можно зачищать. Во время обработки проявка может показать незначительные неровности. В этом случае нужно будет перегрунтовать изъяны или всю деталь.

Грунтовка автомобиля своими руками абсолютно безопасна, если к ней подходить грамотно. Дело в том, что во время проведения любых лакокрасочных работ, в том числе и грунтовки кузова, необходимо пользоваться средствами индивидуальной защиты (респиратор, перчатки, костюм). Пары грунтовки очень вредны для организма. Поэтому будьте внимательны к своему здоровью.

Познавательное видео:

Как правильно нанести грунтовку на стены и потолок, как правильно грунтовать

Чтобы итоговое покрытие настенными и потолочными материалами выглядело как нельзя лучше, следует придерживаться нескольких пунктов и рекомендаций.

Нужно ли разводить с водой

Если речь идёт о готовой смеси — ее достаточно хорошенько размешать. Концентрат же требует добавления воды. Отношение грунтовой пропитки к воде: два к одному, но обычно производитель уточняет об этом на упаковке индивидуально для своего продукта.

Использовать полученный раствор необходимо в тот же день, так как потом он станет непригодным.

Какой лучше валик выбрать

В магазине представлен широкий ассортимент валиков. Практический опыт показывает, какими из них работать лучше и удобнее в той или иной ситуации.

Валик состоит из рукоятки с держателем и ролика. Рукоятку принято выбирать прочную, чтобы инструмент прослужил долгие годы. Ролик с «шубкой» из поролона, меха, велюрасо временем изнашивается и требует замены.

Поролоновый применяют для нанесения смеси густой консистенции. Меховой считается универсальным, он подходит как для густой, так и для жидкой смеси. Желательная длина ворса — 15 мм.

Велюровый также справляется с жидкими и густыми составами. Ворс такого типа валика не превышает 5 мм, поэтому им следует грунтовать исключительно гладкие поверхности.

В труднодоступных местах (за трубами, батареями, в углах, примыканиях), где нужно тщательно нанести грунт, удобно работать специальным угловым валиком или кистью.

Каким валиком лучше быстрее грунтовать

Для ускоренного темпа работы стоит воспользоваться меховым валиком и удлинителем рукоятки с телескопической конструкцией.

Нужно ли мыть стены

Перед непосредственным нанесением грунтовочного покрытия следует убедиться, что обрабатываемое место очищено от грязи и пыли. Достаточно пройтись по нему простым шпателем, а затем влажной губкой.

Сколько слоев нужно нанести

Количество наносимых слоев зависит от степени неровностей стен и потолков. Мастера рекомендуют грунтовать в два слоя для достижения качественного результата. Причем после каждого слоя обязательно дать покрытию высохнуть.

Нанесение

Для начала требуется правильно определиться с выбором грунтовочной смеси. Он зависит от:

  • гладкости/пористости поверхности;
  • типа финишного отделочного материала.

Совершенно неважно — стены или потолок необходимо пропитать, в этом плане разделения нет.

Процесс работы нельзя назвать сложным. Для удобства и наилучшего результата необходимо воспользоваться специальным лотком — малярной ванночкой, куда следует перелить часть строительной пропитки. Валик, смоченный в составе, раскатывается по ванночке, отжимая излишки. Это обязательное условие, чтобы во время обработки жидкая смесь не стекала с поверхности.

Грунтовочный состав необходимо наносить тонким слоем, во избежание скоплений.Вначале следует пропитать углы и примыкания, далее — основные поверхности.

Чем разбавлять грунтовку?

Грунтовки не только разные по составу, они разные и по способу нанесения и по поверхностям на которых используются (пористые основания, не пористые, впитывающие, не впитывающие и.т.п).

Есть грунтовки-концентрат (вариант довольно экономичный в использовании).

Вот к примеру такая акриловая грунтовка (акриловые грунтовки чаще всего используют при различных строительных работах) «Тициана» (Ticiana, работает по кирпичу, бетону, по различным видам штукатурок, укрепляет поверхность)

так как концентрат, то надо разбавлять перед нанесением, разбавляется обычной водой из под крана, вода чистая, температура комнатная, пропорции на таре (см. выше подчеркнул чертой), в даном случае это 1:4 (четыре части воды), встречал концентрированные грунтовки и 1:10-и.

Если Вы купили просто акриловую грунтовку (не концентрат) то ни чем её разбавлять не надо, это готовый состав, взболтайте канистру, вылейте ведро и можно пользоваться.

Есть автомобильные грунтовки, разводятся «родным» (читаем на таре какой растворитель в её составе) растворителем, можно и универсальный вариант использовать к примеру «646» растворитель.

Вывод:

Далеко не все грунтовки требуют разбавления, чем разбавлять эта информация есть на таре (см. выше), а разбавляются начиная от воды из под крана, растворителей и заканчивая фирменными («родными», от одного производителя) разбавителями под конкретные грунтовки (такой вариант чаще встречается в случае авто-грунтовок).

От того, насколько будет ровной базовая поверхность, зависит качество оклейки обоями, покраска или наложение декоративной штукатурки.

Но чтобы именно так и получилось, необходимо в точности соблюдать технологию отделочных работ, хотя многие начинающие почему-то забывают о таком этапе как грунтовка.

Как наносить грунтовку на стены?

Грунтовка представляет собой клеящий раствор и предназначена для скрепления поверхности базового покрытия, перед нанесением на него клеевых составов.

Верное подтверждение того, что стена готова под чистовые работы – это отсутствие опадания каких-либо фракций с нее, при проведении каким-нибудь твердым предметом по поверхности штукатурки, в противном случае, проводить чистовые отделочные работы нельзя. Грунтовка выполняется перед:

  • Оштукатуриванием цементно-песчаной смесью;
  • Стартовой шпаклевкой;
  • Оклейкой обоями.

Таким образом, процесс грунтования будет проводиться три раза, причем каждый раз в два слоя, но при этом можно использовать один и тот же инструмент.

Для грунтования на открытых участках применяют валик, а в углах пользуются квадратной кистью, сперва необходимо обработать именно эти места, обильно пройдясь по стыкам ворсом кисти, зато в последующие разы этого можно не делать.

Грунтовочный раствор необходимо налить в пластиковый поддон и периодически смачивать в нем валик, перед раскатыванием по стене, с валика надо удалить излишки жидкости, поскольку она имеет низкую плотность и при избытке станет стекать с ворса. После высыхания первого слоя, аналогично выполняют второй.

Как разводить грунтовку для стен?

Надо сказать, что грунтовка хотя и не самая дорогая составляющая ремонта, однако, при отделке большой площади ее понадобится достаточно много, особенно подготавливая оштукатуренную поверхность под шпаклевку, как известно, цементно-песчаная смесь прекрасно впитывает влагу.

Именно поэтому многие и даже опытные штукатуры практикуют разбавление раствора водой, но в каких случаях это можно делать и каким способом?

Если грунтовка концентрированная, что делается для удобства транспортировки, то разбавлять ее не только можно, но и нужно, делается это в пропорции указанной на упаковке. Для обычной грунтовки все зависит от производителя и обрабатываемой поверхности.

Рекомендуется пропорция – на две части грунта одна часть воды, но необходимое условие – раствор должен быть использован сейчас же и весь, так как к следующему дню его качества значительно ухудшатся.

Разбавлять можно грунт наносимый на бетонную стену под штукатурку или на шпаклевку под обои, а вот на штукатурку под шпаклевку не рекомендуется, так как цементно-песчаная смесь достаточно хорошо впитывает влагу, а от слабого содержания связующих, она может начать отслаиваться.

Чем заменить грунтовку для стен?

Иногда по каким-то причинам, грунтовки не хватает, а если остается обработать небольшой участок поверхности, то посещение магазина нецелесообразно и в таком случае на помощь могут придти различные способы замены грунтующего состава.

Основное предназначение грунтовки, это скрепление поверхности, чтобы она не «сыпалась», значит и замещающее средство должно обладать похожими свойствами. Необходимо иметь ввиду, что ни один заменитель не будет лучше и дешевле грунтовки, поэтому лучше все-таки найти возможность приобрести этот материал.

В качестве заменителя можно использовать разбавленный клей ПВА или водно-дисперсионную краску, а единственным фабричным заменителем можно считать шпатлевку, которая укладывается на штукатурку без грунтовки.

Также вам будет полезно:

  • Полезная информация о том, что такое грунтовка стен.
  • Как грунтовать стены – много полезного материала здесь http://postroyka.org/kak-gruntovat-stenyi/

Но стоить такое решение будет естественно дороже, хотя если необходимо сэкономить время, то это самый оптимальный вариант.

Также вам будет интересно видео о том, как правильно грунтовать стены

Для чего нужна грунтовка?

Перед покраской кузова или отдельной детали, грунтовка выполняет ряд полезных функций, которые обеспечивают качественное финишное покрытие.

Во-первых, фосфатный грунт служит для предотвращения и удаления ржавчины с поверхности металла.

Во-вторых, основной слой грунтовки выравнивает плоскость, заполняя мелкие неровности, и обеспечивает хорошую защиту поверхности от воздействия воды и механических факторов.

В-третьих, это повышение адгезии краски с металлом в качестве промежуточного слоя.

К тому же есть специальные грунты для колесных арок, которые выдерживают достаточно серьезные механические воздействия и предотвращают повреждение лакокрасочного слоя и последующую коррозию металла.

Подготовительные работы

Перед тем как наносить грунтовку на машину, важным моментом являются и предшествующие ей этапы подготовки.

Из основных шагов можно выделить шлифовку и зачистку поверхности. Сюда входит не только зачистка ржавчины и сколов с царапинами, но и снятие вздувшихся и отколовшихся слоев старого ЛКП.

Далее поверхность обезжиривают и наносят шпаклевку в местах, где это требуется. Обычно это царапины, сколы, вмятины, которые предварительно были выпрямленные, но есть мелкие неровности. Обязательно выждать полного высыхания шпаклевки, так как некоторые ее виды хорошо впитывают влагу, и способны задерживать ее внутри, образуя очаги коррозии. Высохшая шпаклевка шлифуется и обезжиривается с помощью Уайт-спирит, а далее протирается сухой салфеткой без ворса.

Технология работы с грунтовкой

Теперь давайте более детально разберем этот этап работ. В первую очередь нужно подготовить рабочую зону. Если это гараж, то желательно чтобы он был чистый, хорошо освещенный, теплый и в нем присутствовала вентиляция. Таким образом, вы сможете избежать установки дополнительных источников обогрева в виде ИК обогревателей или же появлению скоплений пыли на кузове.

На следующем шаге необходимо обклеить все необрабатываемые участки кузова, куда может попасть материал, при нанесении краскопультом, а также снять все пластиковые накладки на детали, которая будет перекрашиваться. Обычно закрывают все пленкой с помощью малярного скотча, оставляя только те участки поверхности металла, на которые будет наноситься грунтовка.

Из материалов и инструментов вам будут нужны:

  • шлифовальная машинка с различными сменными абразивами.
  • наждачная бумага.
  • грунт, растворитель и отвердитель.
  • краскопульт и воздушный компрессор.

Это базовый набор оборудования и расходных материалов.

Следующий этап – это приготовление готового состава грунтовки перед покраской автомобиля. Тут важно четко соблюдать пропорции указанные производителем материала на упаковке. Желательно использовать отвердитель и растворитель той же марки, чтобы не возникало проблем с различием состава. В качестве растворителя можно взять и 646-й. Для соблюдения пропорции можно использовать мерные емкости, не делайте все на глаз, особенно если вы не опытный маляр. Далее состав фильтруют специальными фильтрами, которые предлагают производители, в противном случае берете марлю, складываете в 3 – 4 слоя и прогоняете готовый состав грунтовки через нее. Делается это для отсеивания различных комков и мусора, которые в последующем могут забить краскопульт.

В большинстве случае наносят 2 – 3 слоя грунта на поверхность кузова машины, этого достаточно, чтобы обеспечить хорошие условия перед нанесением основной краски.

Многих интересует вопрос: «Сколько сохнет грунтовка перед покраской?». Ответ зависит от типа используемого материала. Так, скажем, если используется отвердитель, то между слоями дают период на высыхание 10 – 15 минут, а финишный слой сушат около 18 — 20 часов. Без использования отвердителя, один слой материала будет высыхать за 24 часа, но очень редко используют такой подход, за счет большой потери времени на работу.

При выборе цвета грунта часто смотрят на оттенок финишной краски. Так, если это светлые тона, то берут белую или комбинируют белую и нужный тон краски. Если поверхность черная, то соответственно берут черный оттенок. Но есть и универсальный цвет – это серый грунт, он используется для поверхностей как светлых, так и темных тонов.

Процесс нанесения слоев

Первый слой грунта обычно наносят достаточно толстым слоем, чтобы равномерно покрыть поверхность, а сам материал будет заполнять все микронеровности и сколы. Далее дают ему просохнуть около 10 – 15 минут. При необходимости затирают проблемные места и наносят второй слой. Ждут, когда он немного высохнет, если все хорошо, то выдерживают около суток и переходят к финишной покраске.

После высыхания нужно зачистить поверхность. Не желательно использовать «мокрую шлифовку», поскольку некоторые виды грунтов впитывают влагу, и этот процесс может привести к появлению ржавчины и вздутию краски в будущем. Шлифуют обычно машинкой. Подготовку под акрил делают с помощью абразивов марки Р-400 и Р-500, а под металлик Р-600 и Р-800.

Если вы решили покрасить новую деталь, которая пришла с завода, то обязательно нужно снять транспортировочный черный грунт с помощью абразива марки Р-240 до металла. В последующем наноситься 2 – 3 слоя грунта. По истечению периода в 15 – 20 минут на деталь наносят проявитель в виде контрастной краски. На следующий день, во время шлифовки, за счет проявителя вы можете увидеть мелкие недочеты и устранить их нанесением дополнительного слоя материала.

Все работы желательно проводить в защитной одежде и очках, перчатках, респираторе. Чтобы избежать попадания краски в глаза или же пыли в дыхательную систему.

Почему грунтовку дополнительно шлифуют? Так как это связующий слой, то он имеет некоторую шероховатость и бугристость, и при неравномерном нанесении такие места могут образовывать дефекты в виде наплывов или подтеков. Работать машинкой или вручную с помощью наждачной бумаги нужно очень аккуратно, ведь вы будете шлифовать тонкий слой грунт краски, если где то появились просветы, то их можно устранить с помощью грунта в аэрозольном баллончике, точечным закрашиванием. Шлифуют мелкозернистым абразивом P800 – P1000. Если есть сильные изъяны, на которые указывает проявитель, то с помощью локально наложенной финишной шпаклевки их устраняют и еще раз грунтуют, добиваясь идеальной поверхности.

Вот видео, с советами по нанесению грунта перед покраской авто.

Виды автомобильных грунтовок

При покупке материала, вам нужно ориентироваться в видах грунтовок, так как каждый тип материала отвечает за свой этап работ.

Существует три основных вида:

  1. Акриловая. Этот тип материала используют как связующий слой между поверхностью металла и основным лакокрасочным покрытием. Он отлично заполняет микронеровности и выравнивает плоскость. Но есть и минус – это гигроскопичность. Он впитывает влагу, и при попадании воды, она может доходить до металла и провоцировать очаги коррозии.
  2. Эпоксидная. Такой грунт образует герметичный слой пленки, которая обеспечивает гидроизоляцию поверхности. Помимо стальных деталей ею покрывают и поверхности из цветных металлов и гальванических покрытий. Также обеспечивает хороший уровень адгезии.
  3. Кислотная (фосфатная). Такой тип материала взаимодействует с металлом, образуя пленку окислов, и проникает внутрь структуры. Фосфатные грунты – это преобразователи ржавчины, и их используют для более надежной защиты кузова от коррозийных процессов.

Все эти типы грунтовок часто используются, но вот объединять их вместе не всегда желательно, можно, если соблюдать технологию. Например, нанеся кислотный грунт на металл и в последующем не выждав полного высыхания нанести эпоксидный, то он нейтрализует действие кислотного. Если правильно выждать период, то все будет нормально. С акриловым грунтом подобных проблем не наблюдается.

otdelkagres.ru

Как развести грунтовку различных видов, пропорции разведения

Большинство грунтовых растворов можно приобрести в специальных строительных магазинах. Зачастую продукция грунтовки представлена в виде сухого грунта, который требуется размешать. Самые концентрированные можно хорошенько развести и наносить на поверхность стен. Правильно как развести грунтовку, узнаем из нашей статьи.

Что использовать в качестве разбавителя для различных видов грунтовок

Грунт различается по своим различным свойствам и применению. При этом выделяются:

  1. Укрепляющего типа.
  2. Повышающего типа (адгезию).

Узнаем, чем правильно разбавить грунтовку.

1.Акриловую называют также дисперсионной или эмульсионной. Этот вид считается универсальным, так как находит применение для всех видов стеновых поверхностей, потолков. Акриловый раствор разбавляется водой. Акриловый может быть и грунт.

Важно!

Нельзя использовать по металлу, так как у нее отсутствуют антикоррозийные свойства.

2.Алкиднаую применяют часто для обработки деревянных стен, полов для дальнейшей покраски. Она проникает глубоко и разрыхляет верхний слой дерева, поэтому раствор обеспечивает наилучшую адгезию основания и краски. Её применяют под эмаль и для работ по металлу. Но не нельзя применять для стен из бетона или камня. Концентрат снижается схожим растворителем, что и содержится в составе грунта, или целесообразно использовать Уайт – спирит, ксилол и другие.

3.Эпоксидную или полиуретановую рекомендуется использовать для нанесения обработки стен, а также потолков под эмаль. Отдельные смеси предопределяются для проведения действий по металлу с последующим нанесением эмульсионной жидкостью. Для нанесения подходит ксилол или иная универсальная смесь. Полистирольного типа применяют для нанесения стеновых покрытий – по штукатурке и дереву. Содержащийся состав считается вредным, так как преобладают токсичные свойства вещества, вследствие этого рекомендуется соблюдать индивидуальную защиту, также хорошо проветривать квартиру во время обработки.

4.Грунтовка для металла относится к отдельной категории.

В составе смеси входят разнообразные вещества, в содержание свойства входят следующие компоненты:

  •  изоляция;
  •  протекция;
  •  преобразование.

Чтобы правильно разбавлять, надо знать, чем разбавить грунтовку. Чтобы её развести, её разбавляют разнообразными растворителями до 10% от всеобщего объёма, но не водой. Раствор для покрытий, состоящих из металла, непременно проводить в несколько слоев под эмаль, а также покраску стеновых поверхностей. Они создают прочную водонепроницаемую пленку.

Перхлорвиниловая предназначается для возделывания наружных стен. Обычно такие растворы имеют нормальную консистенцию. В составе содержится растворитель, им же и разбавляется, если очень вязкий состав. Если развести грунтовку, то она лучше наносится и стремительнее берется. Опытные строители советуют выполнять промежуточные строительно-ремонтные работы непосредственно грунтовкой.

Правильные пропорции при разведении грунтовки

Чтобы развести грунтовку, надо знать точные пропорции для её разведения.

Смесь не самая дорогостоящая для ремонта, но при наличии огромной площади помещения её понадобится довольно много, в особенности, если она пойдет под штукатурку поверхности. Может быть поэтому высококвалифицированные строители разбавляют её водой, но в каких случаях и какие пропорции нужны для её разведения?

Когда она хорошая, концентрированная по своим свойствам, то её обязательно нужно развести, а как это делается можно посмотреть на упаковке, где указана полная информация о применении. Для обыкновенного раствора специалистами рекомендуется следующая пропорция: развести на две части компонента одной части воды.

Важно!

Разбавленную смесь необходимо использовать в полном объеме за раз, так как ее свойства при длительном хранении в разведенном виде значительно ухудшаются.

Разбавленная наносится на бетонную стену под штукатурку или на шпаклевку под клейку обоев, а наносить на штукатурку не рекомендуется, так как смесь, состоящая из цемента и песка, отлично может впитывать влагу, а от небольшого состава, может произойти отслоение.

Когда в доме отсутствует грунтовка, чуть–чуть не хватает для обработки небольшой поверхности участка, посещать магазин не рекомендуется, так как заменить грунт можно другим способом. Главная функция грунтовки – скрепить поверхности, чтобы она не осыпалась, значит и замена её варианта должна быть схожей, обладая аналогичными сходствами. Для замены смеси подойдет разбавленный клей ПВА или подойдет краска водно-дисперсионная. А единственный выход, чтобы заменить грунт является шпатлёвка, которая может укладываться без грунтовки.

Важно!

Имейте ввиду, что грунтовка – самое наилучшее средство для обработки стен, потолков, полов. Заменить её можно только в том случае, когда её не хватает для обработки незначительного участка, а покупать в магазине нецелесообразно из-за маленького объёма работы.

От того, какая будет ровная базовая поверхность, зависит не только от качественной наклейки обоев, но и от наложения декоративной штукатурки. Но чтобы стены были ровными, важно именно на них наносить для этого специально предназначенную грунтовку. По желанию хорошо концентрированный раствор разбавляется.

Нанесением этим составом проводится перед штукатуркой и стартовой шпаклевкой, а также оклейкой обоев. Процесс нанесения грунта осуществляется в три этапа, и каждый раз нужно проводить в несколько слоев специальным валиком. Затем с рабочего валика удаляется лишняя жидкость, а после высыхания первого слоя – выполняется следующий слой.

vsyakraska.ru

Тонкости грунтования стен: для чего это нужно и особенности выбора смесей

Одним из важнейших подготовительных этапов поверхности при ремонте является грунтовка стен. Не все знают об этой обязательной процедуре и зачастую просто ее игнорируют. Отсутствие грунтования на стенах может привести к проблемам в виде плесени или отслоившегося материала отделки. Перед проведением процедуры необходимо подробнее изучить виды и особенности применения грунтовки.

Зачем нужна грунтовка стен

Качественное грунтование обеспечивает стенам защиту от множества факторов. Отсутствие грунта на поверхности делает ее шероховатой, что в последствие влияет на адгезию (сцепление) отделки со стеной. Кроме того, после поклейки под полотнами будут видны мелкие выступающие точки, что обязательно отразится на внешнем виде покрытия.

В некоторых случаях можно обойтись и без грунтовки, но если за цель ставится долговечный и качественный ремонт, лучше выполнить данную процедуру. Укрепление плоскостей и их подготовка под дальнейшую отделку – вот для чего нужна грунтовка стен.

Следует ответить на вопрос о том, что такое грунтовка, какие функции она выполняет:

  • придает прочность обрабатываемой поверхности;
  • предназначена для сцепляемости плоскости с отделкой, поскольку проникает глубоко в поры;
  • способна впитать клеевые составы, шпатлевку и краску, поскольку обладает связующими свойствами..

Данная процедура является завершающим этапом перед отделкой стены. Чаще всего нанесение грунтовки на стены проводится в две фазы, чтобы окончательно укрепить покрытие.

Обладая множеством полезных свойств, грунтовка хорошо устраняет возможный грибок и плесень, а также удаляет оставшиеся частички штукатурки. Обои прослужат дольше и не отклеятся от стен в процессе эксплуатации.

Разновидности смесей

Сегодня в ассортименте имеется множество видов грунтовочных составов, каждый из которых подходит под определенный случай. Грунтовка для плоскостей классифицируется согласно материалу, на котором будет применена. Выделяют такие виды:

  • для металлических оснований;
  • для сыпучих материалов;
  • для деревянных стен.

В грунтовочный состав обычно входят смолы и другие компоненты. Отдельного внимания заслуживает акриловая грунтовка, которая применяется для стен, покрытых шпаклевкой. Состав проникает глубоко в основание, благодаря чему приклеенные обои прочно и надежно крепятся на стену. Иногда заменой такому компоненту является обычный обойный клей, который обладает подобными свойствами.

Для поверхностей из дерева применяются алкидные грунтовочные смеси. Но почему нельзя применять универсальные смеси для дерева? Некоторые изделия совершенно не подходят для обработки древесины. Алкидный состав не только отлично проникает в основание, но и уберегает его от появления паразитов. Кроме того, он создает невидимую прочную пленку на плоскости, которая прекрасно поддается оштукатуриванию. Перед тем как грунтовать стены, убедитесь, что деревянная плоскость лишена выступающих элементов.

Если за цель поставлено самостоятельное приготовление обработки из клея для обоев, при его размешивании добавьте в емкость кусочек стекловолокна. Материал сможет собрать на себя все сгустки и комки состава для грунтовки стен.

Правильные пропорции при разведении

Многие смеси продаются уже готовыми к использованию. Достаточно просто взболтнуть их и определиться, чем наносить грунтовку на стены. Некоторые производители предлагают грунт в виде концентрата, который обязательно нужно развести жидкостью. Необходимо разобраться, как наносить грунтовку на стены так, чтобы это не нанесло вреда будущему покрытию.

Все составы делятся на укрепляющие и повышающие сцепление варианты. В зависимости от основного компонента, изготовители рекомендуют разводить грунтовку поверхности стен следующими жидкостями:

  1. Алкидный концентрированный грунт, применяемый для деревянных плоскостей, лучше развести подобным органическим растворителем по типу уайт-спирита или сольвента в пропорциях 1:1. Необходимо применять разведенное вещество только на поверхностях, указанных на этикетке.
  2. Для растворения эпоксидной грунтовки, предназначенной для обработки бетонных стен, можно использовать ксилол или похожее универсальное вещество в пропорциях 1:1.
  3. Водоэмульсионная или акриловая грунтовка обычно продается разведенной, однако бывает и в виде концентрата. Разбавить его можно с помощью обычной чистой воды в размере 20% воды от объема грунтовки.
  4. Грунтовки по металлу разбавляются растворителями в объеме 10%. Ни в коем случае не рекомендуется добавлять в такие составы воду – срок действия вещества сокращается. Грунтование стен с металлическим основанием предполагает наличие смеси с антикоррозийными свойствами.

Соблюдение пропорций является залогом хорошего результата. Если изготовитель не оставил заметку на этикетке про соразмерность веществ, разводите грунтовку на штукатурку и другие плоскости в объеме не более 5-10% от общего количества состава.

Способы нанесения

Процесс нанесения грунтовочной смеси достаточно прост, однако требует внимания к некоторым деталям. Следует подробнее разобраться в алгоритме действий перед тем как грунтовать стены:

  1. До нанесения смеси очистите всю поверхность от загрязнений.

Для этого можно использовать строительный пылесос, если объемы работ большие. Для небольших площадей применяется широкая кисть, которая с легкостью очищает стену перед нанесением грунта.

  1. Вылейте состав в специальный кювет, в котором тщательно его размешайте.

Для работы используется специальный инструмент – валик. Он смачивается в веществе и раскатывается для удаления излишков. Только тогда можно приступать к процедуре. Если грунт требует разбавления, не забудьте его осуществить именно на данном этапе. Большинство владельцев, самостоятельно осуществляющих ремонт, полагают, что слой грунта должен быть толстым. Это ошибочное утверждение приводит к дефектам.

Перед тем как грунтовка наносится на стену, с поверхности валика удаляется все лишнее, чтобы добиться тонкого слоя.

  1. Когда основное пространство обработано, стоит перейти к угловым участкам. Валик в данной ситуации будет непригоден, здесь смесь наносится с помощью кисточки.
  2. После завершения процедуры стены должны полностью высохнуть.

При необходимости, работу можно повторить, но только после того как впитается первый слой. Грунтовка для стен обычно высыхает за 24 часа – данная информация указывается изготовителем на упаковке.

  1. После того, как стены стали сухими, проводится последующая отделка необходимыми материалами.

Теперь, когда вы знаете, как правильно грунтовать стены, можно приступать к самостоятельному осуществлению процесса.

Тонкости грунтования перед штукатуркой

Важно знать, как правильно подготовить плоскость под штукатурку или шпаклевку. Грунтовка оказывает антисептическое, обезжиривающее и противогрибковое воздействие на бетон, поэтому применять ее нужно в обязательном порядке. Главная особенность применения смеси состоит в том, чтобы каждый последующий слой штукатурки был обработан и полностью высушен. Для штукатурки и шпаклевки применяется акриловая грунтовка – она наиболее уместна в данном типе работ.

На видео: тонкости грунтования.

Работа по грунтованию производится для того, чтобы не произошло отслаивания штукатурки в процессе эксплуатации – смесь надежно закрепит ее на плоскости. Сама процедура грунтовки стен осуществляется тем же методом, что и при обработке поверхности перед поклейкой обоев.

Прежде чем начать грунтовать, стены должны подсохнуть. Тонкий и аккуратный слой состава проще закрепится под материалом штукатурки. То же самое касается и шпаклевки: благодаря мелкой зернистости она лучше ляжет на грунтованную плоскость.

Современные отделочные смеси имеют высокую стоимость. Но зачем грунтовать стены в таком случае, разве нельзя сэкономить? И вновь вспомните о том, что неподготовленное основание может неплохо испортить покрытие. Не пренебрегайте использованием грунта перед отделкой декоративной штукатуркой.

Особенности выбора

Первоначально для выбора состава важно определиться, насколько сильно основание стены впитывает жидкость. Этот фактор обуславливает пористость плоскости. В зависимости от степени проникновения грунтовки на штукатурку, бетон или дерево, выберите соответствующий тип грунтовки:

  1. Для менее пористых покрытий выбирайте грунт с хорошей адгезией.
  2. Стены со средней пористостью отлично впитывают любой состав, такие вещества сохнут очень быстро.
  3. Для плоскостей с крупными порами нужна грунтовка глубокого проникновения

Стену, изготовленную из бетона, грунтуют специальным минеральным составом. Такой метод позволяет максимально увеличить адгезию поверхности к будущей отделке. Если работы проводятся в помещениях с высокой влажностью, тогда нужно использовать грунт со специальным составом, предотвращающий появление грибка.

Перед тем как начать наносить строительную грунтовку на вашу стену, на ней не должно быть посторонних частиц. Позаботьтесь об этом заранее. Достигнуть качественного результата можно только при соблюдении всех указанных правил и методик. Не стоит покупать первую увиденную в магазине смесь. Чем лучше состав будет подходить под определенные нужды, тем лучше получится ремонт.

Рекомендуем прочитать:

gidpokraske.ru

как наносить и как разводить грунтовку для стен? Чем заменить грунтовку для стен? —  

как наносить и как разводить грунтовку для стен? Чем заменить грунтовку для стен?

От того, насколько будет ровной базовая поверхность, зависит качество оклейки обоями, покраска или наложение декоративной штукатурки.

Но чтобы именно так и получилось, необходимо в точности соблюдать технологию отделочных работ, хотя многие начинающие почему-то забывают о таком этапе как грунтовка.

Как наносить грунтовку на стены?

Грунтовка представляет собой клеящий раствор и предназначена для скрепления поверхности базового покрытия, перед нанесением на него клеевых составов.

Верное подтверждение того, что стена готова под чистовые работы – это отсутствие опадания каких-либо фракций с нее, при проведении каким-нибудь твердым предметом по поверхности штукатурки, в противном случае, проводить чистовые отделочные работы нельзя. Грунтовка выполняется перед:

  • Оштукатуриванием цементно-песчаной смесью;
  • Стартовой шпаклевкой;
  • Оклейкой обоями.

Таким образом, процесс грунтования будет проводиться три раза, причем каждый раз в два слоя, но при этом можно использовать один и тот же инструмент.

Для грунтования на открытых участках применяют валик, а в углах пользуются квадратной кистью, сперва необходимо обработать именно эти места, обильно пройдясь по стыкам ворсом кисти, зато в последующие разы этого можно не делать.

Грунтовочный раствор необходимо налить в пластиковый поддон и периодически смачивать в нем валик, перед раскатыванием по стене, с валика надо удалить излишки жидкости, поскольку она имеет низкую плотность и при избытке станет стекать с ворса. После высыхания первого слоя, аналогично выполняют второй.

Как разводить грунтовку для стен?

Надо сказать, что грунтовка хотя и не самая дорогая составляющая ремонта, однако, при отделке большой площади ее понадобится достаточно много, особенно подготавливая оштукатуренную поверхность под шпаклевку, как известно, цементно-песчаная смесь прекрасно впитывает влагу.

Именно поэтому многие и даже опытные штукатуры практикуют разбавление раствора водой, но в каких случаях это можно делать и каким способом?

Если грунтовка концентрированная, что делается для удобства транспортировки, то разбавлять ее не только можно, но и нужно, делается это в пропорции указанной на упаковке. Для обычной грунтовки все зависит от производителя и обрабатываемой поверхности.

Рекомендуется пропорция – на две части грунта одна часть воды, но необходимое условие – раствор должен быть использован сейчас же и весь, так как к следующему дню его качества значительно ухудшатся.

Разбавлять можно грунт наносимый на бетонную стену под штукатурку или на шпаклевку под обои, а вот на штукатурку под шпаклевку не рекомендуется, так как цементно-песчаная смесь достаточно хорошо впитывает влагу, а от слабого содержания связующих, она может начать отслаиваться.

Чем заменить грунтовку для стен?

Иногда по каким-то причинам, грунтовки не хватает, а если остается обработать небольшой участок поверхности, то посещение магазина нецелесообразно и в таком случае на помощь могут придти различные способы замены грунтующего состава

.

Основное предназначение грунтовки, это скрепление поверхности, чтобы она не «сыпалась», значит и замещающее средство должно обладать похожими свойствами. Необходимо иметь ввиду, что ни один заменитель не будет лучше и дешевле грунтовки, поэтому лучше все-таки найти возможность приобрести этот материал.

В качестве заменителя можно использовать разбавленный клей ПВА или водно-дисперсионную краску, а единственным фабричным заменителем можно считать шпатлевку, которая укладывается на штукатурку без грунтовки.

Также вам будет полезно:

Но стоить такое решение будет естественно дороже, хотя если необходимо сэкономить время, то это самый оптимальный вариант.

Также вам будет интересно видео о том, как правильно грунтовать стены

Твитнуть

Как применять грунтовку грубокого проникновения

Содержание статьи:

Многие виды строительно-отделочных работ выполняются только после применения грунтовки глубокого проникновения. Она является связующим слоем, снижает впитываемость обрабатываемого материала, а также придаёт некоторым из них особенные качества — устойчивость к влаге, плесени.

Грунт относится к строительной химии и служит для подготовки плоскости под последующую отделку. Краска, обои, шпатлёвка, штукатурка, стяжка и другие строительно-отделочные материалы гораздо лучше держатся на поверхности, если она подготовлена с применением пропитывающей грунтовки. Познакомимся с ней поближе.

Состав грунтовки глубокого проникновения

Грунт – это эмульсия, то есть взвесь полимерной смолы (чаще всего акрилового типа) в воде с добавлением смягчающих и разжижающих веществ.

Показатели смачиваемости и капилярного проникновения грунтовки выше, чем, например, воды из крана, поэтому она легко и глубоко проникает в пористые и рыхлые материалы, заполняет пространство между их твёрдыми частичками. После испарения воды она полимеризуется, обволакивая и склеивая частички, а значит дополнительно цементируя структуру материала.

Подбирайте грунтовку только для того основания на которое она будет наноситься и для того покрытия, которое будет наносится на грунтованную поверхность. Идеально вариант — использование ґрунтовки одной торговой марки с материалом последующего слоя.

Функции и характеристика грунтовок

Грунтовка глубоко проникает в цементно-известковое или бетонное основание и, полимеризуясь внутри, связывает его частички и укрепляет структуру. Образуется скреплённый монолит, воздухо- и паропроницаемый, более устойчивый к воздействию влаги, физическому воздействию (вибрация, удары, трение) и изменению температур.

Грунтование улучшает адгезию основания, то есть его способность принимать, удерживать и схватываться с отделочными материалами органического происхождения (клей, краска) или строительными смесями с органическими добавками (самонивелир, штукатурка, шпатлёвка).

Само основание имеет, как правило, неорганический характер (песок, известь, цемент) или органический (дерево, ДВП, ДСП, бумага), но не родственный полимерам, применённым в отделочных составах.

Укрепляющая грунтовка глубокого проникновения углубляется в обрабатываемую поверхность, склеивает её частички и волокна, обволакивает их полимерной плёнкой, с которой в последствие и схватывается родственный полимер из наносимого раствора.

Обработанная плоскость плавно (равномернее и дольше) отнимает влагу из наносимого раствора, что позволяет избежать возникновения внутренних напряжений как в структуре самого раствора (штукатурки, шпаклёвки, краски, клея) так и в плоскости соприкосновения раствора и основания.

Соответственно, грунтование страхует от чрезмерной усадки, растрескивания и отслоения раствора после высыхания и в процессе дальнейшей эксплуатации.

Применение грунтовки глубокого проникновения

  • Подготовка цементно-известковых и бетонных оснований к шпаклеванию или заштукатуриванию.
  • Подготовка оштукатуренных и зашпаклёванных поверхностей к покраске, нанесению побелки, оклейке обоями, пенополистирольными плитами, панелями, керамической плиткой и так далее.
  • Подготовка бетонного пола к использованию стяжки, самонивелирующегося раствора или ремонтной шпаклёвки.
  • Подготовка бетонного пола к укладке линолеума, коврового покрытия, керамической плитки.
  • Подготовка ДВП, ДСП, гипсокартона, дерева к шпаклеванию, покраске или оклейке обоями.
  • Пропитывание зафугованных швов между керамическими плитками для защиты фуги от вымывания водой.
  • Пропитывание поверхностей антисептической грунтовкой глубокого проникновения для профилактики появления плесени и грибков гниения.
  • Праймирование, то есть приготовление мальмы «молочка» путём добавления в грунтовку небольшого количества сухой строительной смеси и применение этого раствора за 20-30 минут до нанесения самонивелира, штукатурки. Данная операция используется для исключения внутренних напряжений в плоскости соприкосновения высыхающей строительной смеси и гигроскопичного пористого основания.

Можно ли разбавлять грунтовку водой

Грунтовку глубокого проникновения можно разбавлять водой только в пределах 10% от общего объёма. Больше 10% нельзя ни в коем случае, так как она начинает терять свои основные свойства. Смысл в её использование в разбавленном виде пропадает вообще. Исключение составляет лишь концентрированная грунтовка. Её разводить необходимо в пропорциях, указанных в инструкции по применению.

Главное правило при покупке и дальнейшем использовании — читайте внимательно инструкцию по применению и чётко ей следуйте. Каждый производитель указывает на упаковке правила разбавления грунтовки.

Можно ли грунтовать разбавленной пожиже краской

Мой ответ нет, так как ни одна из трёх целей грунтования не будет достигнута при помощи разбавленной пожиже краски:

  • не будет структурного укрепления основания, так как краска не проникнет глубоко;
  • не будет улучшения адгезии, так как слой или плёнка краски сама не надёжно держится за непрогрунтованное основание;
  • не будет нивелирования внутренних напряжений при нанесении последующих слоёв отделки, так как тонкая плёнка высохшей краски не сдержит резкий отход влаги из наносимых растворов в гигроскопичное основание.

Кроме того, большинство красок уже разбавлены до рабочей вязкости на заводе и дальнейшее разведение может привести к дестабилизации дисперсии — превратится в побелку, которая мажется. Поэтому грунтовать разбавленной пожиже краской нельзя!

Обязательно применяйте для этих целей пропиточную грунтовку. Соблюдайте все технологические процессы и мои рекомендации описанные на сайте, и тогда у Вас получится идеальный ремонт своими руками!

Как развести грунтовку различных видов, пропорции разведения

Большинство грунтовых растворов можно приобрести в специальных строительных магазинах. Зачастую продукция грунтовки представлена в виде сухого грунта, который требуется размешать. Самые концентрированные можно хорошенько развести и наносить на поверхность стен. Правильно как развести грунтовку, узнаем из нашей статьи.

Что использовать в качестве разбавителя для различных видов грунтовок

Грунт различается по своим различным свойствам и применению. При этом выделяются:

  1. Укрепляющего типа.
  2. Повышающего типа (адгезию).

Узнаем, чем правильно разбавить грунтовку.

1.Акриловую называют также дисперсионной или эмульсионной. Этот вид считается универсальным, так как находит применение для всех видов стеновых поверхностей, потолков. Акриловый раствор разбавляется водой. Акриловый может быть и грунт.

Важно!

Нельзя использовать по металлу, так как у нее отсутствуют антикоррозийные свойства.

2.Алкиднаую применяют часто для обработки деревянных стен, полов для дальнейшей покраски. Она проникает глубоко и разрыхляет верхний слой дерева, поэтому раствор обеспечивает наилучшую адгезию основания и краски. Её применяют под эмаль и для работ по металлу. Но не нельзя применять для стен из бетона или камня. Концентрат снижается схожим растворителем, что и содержится в составе грунта, или целесообразно использовать Уайт – спирит, ксилол и другие.

3.Эпоксидную или полиуретановую рекомендуется использовать для нанесения обработки стен, а также потолков под эмаль. Отдельные смеси предопределяются для проведения действий по металлу с последующим нанесением эмульсионной жидкостью. Для нанесения подходит ксилол или иная универсальная смесь. Полистирольного типа применяют для нанесения стеновых покрытий – по штукатурке и дереву. Содержащийся состав считается вредным, так как преобладают токсичные свойства вещества, вследствие этого рекомендуется соблюдать индивидуальную защиту, также хорошо проветривать квартиру во время обработки.

4.Грунтовка для металла относится к отдельной категории.

В составе смеси входят разнообразные вещества, в содержание свойства входят следующие компоненты:

  •  изоляция;
  •  протекция;
  •  преобразование.

Чтобы правильно разбавлять, надо знать, чем разбавить грунтовку. Чтобы её развести, её разбавляют разнообразными растворителями до 10% от всеобщего объёма, но не водой. Раствор для покрытий, состоящих из металла, непременно проводить в несколько слоев под эмаль, а также покраску стеновых поверхностей. Они создают прочную водонепроницаемую пленку.

Перхлорвиниловая предназначается для возделывания наружных стен. Обычно такие растворы имеют нормальную консистенцию. В составе содержится растворитель, им же и разбавляется, если очень вязкий состав. Если развести грунтовку, то она лучше наносится и стремительнее берется. Опытные строители советуют выполнять промежуточные строительно-ремонтные работы непосредственно грунтовкой.

Правильные пропорции при разведении грунтовки

Чтобы развести грунтовку, надо знать точные пропорции для её разведения.

Смесь не самая дорогостоящая для ремонта, но при наличии огромной площади помещения её понадобится довольно много, в особенности, если она пойдет под штукатурку поверхности. Может быть поэтому высококвалифицированные строители разбавляют её водой, но в каких случаях и какие пропорции нужны для её разведения?

Когда она хорошая, концентрированная по своим свойствам, то её обязательно нужно развести, а как это делается можно посмотреть на упаковке, где указана полная информация о применении. Для обыкновенного раствора специалистами рекомендуется следующая пропорция: развести на две части компонента одной части воды.

Важно!

Разбавленную смесь необходимо использовать в полном объеме за раз, так как ее свойства при длительном хранении в разведенном виде значительно ухудшаются.

Разбавленная наносится на бетонную стену под штукатурку или на шпаклевку под клейку обоев, а наносить на штукатурку не рекомендуется, так как смесь, состоящая из цемента и песка, отлично может впитывать влагу, а от небольшого состава, может произойти отслоение.

Когда в доме отсутствует грунтовка, чуть–чуть не хватает для обработки небольшой поверхности участка, посещать магазин не рекомендуется, так как заменить грунт можно другим способом. Главная функция грунтовки – скрепить поверхности, чтобы она не осыпалась, значит и замена её варианта должна быть схожей, обладая аналогичными сходствами. Для замены смеси подойдет разбавленный клей ПВА или подойдет краска водно-дисперсионная. А единственный выход, чтобы заменить грунт является шпатлёвка, которая может укладываться без грунтовки.

Важно!

Имейте ввиду, что грунтовка – самое наилучшее средство для обработки стен, потолков, полов. Заменить её можно только в том случае, когда её не хватает для обработки незначительного участка, а покупать в магазине нецелесообразно из-за маленького объёма работы.

От того, какая будет ровная базовая поверхность, зависит не только от качественной наклейки обоев, но и от наложения декоративной штукатурки. Но чтобы стены были ровными, важно именно на них наносить для этого специально предназначенную грунтовку. По желанию хорошо концентрированный раствор разбавляется.

Нанесением этим составом проводится перед штукатуркой и стартовой шпаклевкой, а также оклейкой обоев. Процесс нанесения грунта осуществляется в три этапа, и каждый раз нужно проводить в несколько слоев специальным валиком. Затем с рабочего валика удаляется лишняя жидкость, а после высыхания первого слоя – выполняется следующий слой.

Как разводить грунтовку своими руками?

Многие грунтовки, которые продаются в магазинах, являются готовыми к использованию, их нужно просто размешать, после чего они наносятся на поверхность. Однако есть и концентрированные составы, которые необходимо разбавлять. К тому же, грунтовку для стен необходимо разводить, если она имеет вид сухого порошка. Чем нужно правильно разводить грунт, какой использовать растворитель, и как правильно это делается?
В зависимости от состава грунтовки, нужно использовать разные растворители. К примеру, водно-дисперсионные составы разбавляют обыкновенной водой. Для других смесей необходимо использовать органические растворители. Разбавитель подбирается в зависимости от типа грунта, а также от вида поверхности, на которую будет наноситься смесь. Если планируется работать с очень пористым материалом, то специалисты вообще не советуют разбавлять концентрированный состав.

Преимущества грунтования

Обработанная грунтом поверхность имеет множество достоинств:

  •  финишный отделочный материал ложится очень легко и качественно;
  •  значительно продлевается эксплуатационный срок отделки;
  •  глубоко проникающие составы существенно уменьшают пористость стен, укрепляют их и защищают от осыпания;
  •  грунтованная поверхность практически не изнашивается, смесь на протяжении многих лет создает эффективную защиту от коррозии;
  •  скрывает, исправляет незначительные дефекты на стенах или на потолке;
  •  смесь очень хороша для покраски, лакировки и шпаклевки, благодаря правильно подобранному продукту в значительной мере уменьшается расход финишного материала для отделки;
  •  если в грунте есть антисептические добавки, то поверхность становится дезинфицированной, на ней не появляется плесень, грибки, не заводятся различные микроорганизмы и вредители.

Рекомендуем прочитать: как отмыть грунтовку

Чем разбавлять?

Многие из тех, кто приобретает смесь для обработки поверхности, задаются вопросом: чем и как разводится грунтовка для покраски или для шпаклевки? Всё зависит от приобретаемого типа продукции, сейчас продаются укрепляющие смеси и грунтовки, увеличивающие адгезию. По составу бывают такие материалы:

  •  акриловые, их также называют эмульсионные или дисперсионные. Они являются универсальными, ведь используются для любого вида стен, полов и потолков, однако их нельзя применять для обработки металла, они не имеют антикоррозионных составляющих. Чтобы развести грунтовку этого вида, можно воспользоваться обычной водой. Акриловая продукция является не токсичной, чаще всего она не обладает никаким запахом. Чтобы правильно развести данный грунт, моно проконсультироваться у продавца или ознакомиться с инструкцией на упаковке, однако зачастую акриловые укрепляющие смеси и глубокого проникновения разводятся простой водой;
  •  алкидные грунтовки используются чаще всего для нанесения на деревянные изделия и любые основания из древесины, для покраски. Благодаря глубокому проникновению эти составы обеспечивают отличную адгезию древесины и лакокрасочных материалов. Они также используются для нанесения на разные металлы, но их не стоит применять для бетонных и кирпичных построек. Как правильно разводить грунтовку этого вида? Обычно используют такой же растворитель, который входит в состав этого грунта, но можно применять другие растворители, например, сольвент или уайт-спирит;
  •  полиуретановые и эпоксидные составы применяют, чтобы обрабатывать бетонные стены или потолки, используются они для покраски. Некоторые из видов этих продуктов могут быть использованы для защиты от появления ржавчины на металле, после чего изделия окрашиваются эмалью. Как нужно разводить эту грунтовку для стен и для других поверхностей? В качестве растворителя можно использовать ксилол или какой-либо другой универсальный растворитель, которого должно быть примерно 5-10 процентов, не больше;
  •  полистирольные грунты применяют для нанесения на оштукатуренные или деревянные стены, эти грунтовки являются токсичными, поэтому нужно надевать индивидуальные средства защиты, и следить за тем, чтобы вентиляция в помещении была достаточной во время выполнения работы. Желательно использовать для наружных, фасадных стен. Чтобы развести грунтовку этого вида, нужно соблюдать инструкцию, в которой будет указано, какой растворитель необходимо использовать;
  •  смеси для обработки металла состоят из разных компонентов, которые могут преобразовывать ржавчину, создавать изоляционный или защитный слой. Эти концентраты нужно правильно развести при помощи рекомендуемого изготовителем растворителя, объем которого должен быть максимум 10 процентов от объема смеси. Данные грунты нельзя разбавлять водой. Чаще всего используют универсальные разбавители;
  •  перхлорвиниловые препараты используют, чтобы обрабатывать фасадные кирпичные и бетонные стены. Зачастую они реализуются готовыми к использованию, не нуждаются в разбавлении. Однако при повышенной вязкости можно использовать органические растворители, сольвент или ксилол, который обычно входит в состав этих продуктов.

Разбавляют смеси для грунтования, чтобы они лучше ложились на поверхность и быстрее высыхали. Разводить грунты нужно практически всех видов, кроме глубоко проникающих составов, которые гораздо лучше проявляют себя, и работать с которыми намного легче в оригинальном, не разбавленном состоянии.

Вывод

Специалисты советуют обязательно использовать подходящий вид грунтовочный продукции во время выполнения ремонтных или отделочных работ. При нанесении нескольких слоев грунта поверхность будет прочная, отделка прослужит гораздо дольше. Чтобы разводить грунтовочные составы, можно руководствоваться информацией из этой статьи, кроме этого, можно проконсультироваться у опытного продавца, а также обязательно прочитать инструкцию по применению продукции и использовать именно тот вид разбавителя в необходимой пропорции, которую рекомендует изготовитель.

нужно ли разводить грунтовку водой, сколько слоев стоит нанести на разные поверхности валиком, какой смеси отдать предпочтение

Скромная снаружи, но такая важная внутри. Речь о грунтовочной смеси и ее мощных функциях. Благодаря ей настенные и потолочные покрытия отлично держатся и прекрасно смотрятся.

  1. Грунтовка — залог красивой поверхности и качественного ремонта
  2. Что такое грунтовка
  3. Когда применяется огрунтовка
  4. Как правильно нанести грунтовку на стены и потолок, как правильно грунтовать
  5. Нужно ли разводить с водой
  6. Какой лучше валик выбрать
  7. Каким валиком лучше быстрее грунтовать
  8. Нужно ли мыть стены
  9. Сколько слоев нужно нанести
  10. Нанесение
  11. Популярные грунтовки
  12. Когда можно проводить покраску, поклейку
  13. Полезное видео

Грунтовка — залог красивой поверхности и качественного ремонта

Ремонт требует основательного подхода, физических усилий и финансовых затрат.

Чтобы результат радовал своих хозяев долго, важно ничего не упустить.

Привести стены и потолки в достойный вид без грунтовочной пропитки не выйдет.

Что такое грунтовка

Это строительный состав в виде жидкости, которым обрабатывают стены, полы, потолки.
Выполняет следующие задачи:

  • усиливает адгезию — сцепление разнородных материалов, в данном случае между
  • обрабатываемой поверхностью и отделкой;
  • укрепляет основание;
  • выравнивает слой;
  • защищает от коррозии;
  • экономит расход краски.

Состав смеси зависит от ее прямого назначения и типа поверхности. Накладывается она на:

  • бетон;
  • кирпич;
  • дерево;
  • гипсокартон;
  • старую краску.

Когда применяется огрунтовка

Процесс огрунтовки происходит перед:

  • поклейкой обоев;
  • укладкой кафельной плитки;
  • нанесением побелки/свежей краски, для наилучшего скрепления отделочных
  • материалов с основанием.

Вначале обрабатываемые места нужно отштукатурить и выровнять шпаклевкой, затем дать им полностью высохнуть.

Только после этих операций возможно нанесение грунтовочного покрытия.

Как правильно нанести грунтовку на стены и потолок, как правильно грунтовать

Чтобы итоговое покрытие настенными и потолочными материалами выглядело как нельзя лучше, следует придерживаться нескольких пунктов и рекомендаций.

Нужно ли разводить с водой

Если речь идёт о готовой смеси — ее достаточно хорошенько размешать. Концентрат же требует добавления воды. Отношение грунтовой пропитки к воде: два к одному, но обычно производитель уточняет об этом на упаковке индивидуально для своего продукта.

Какой лучше валик выбрать

В магазине представлен широкий ассортимент валиков. Практический опыт показывает, какими из них работать лучше и удобнее в той или иной ситуации.

Валик состоит из рукоятки с держателем и ролика. Рукоятку принято выбирать прочную, чтобы инструмент прослужил долгие годы. Ролик с «шубкой» из поролона, меха, велюра
со временем изнашивается и требует замены.

Поролоновый применяют для нанесения смеси густой консистенции. Меховой считается универсальным, он подходит как для густой, так и для жидкой смеси. Желательная длина ворса — 15 мм.

Велюровый также справляется с жидкими и густыми составами. Ворс такого типа валика не превышает 5 мм, поэтому им следует грунтовать исключительно гладкие поверхности.

Каким валиком лучше быстрее грунтовать

Для ускоренного темпа работы стоит воспользоваться меховым валиком и удлинителем рукоятки с телескопической конструкцией.

Нужно ли мыть стены

Перед непосредственным нанесением грунтовочного покрытия следует убедиться, что обрабатываемое место очищено от грязи и пыли. Достаточно пройтись по нему простым шпателем, а затем влажной губкой.

Сколько слоев нужно нанести

Количество наносимых слоев зависит от степени неровностей стен и потолков. Мастера рекомендуют грунтовать в два слоя для достижения качественного результата. Причем после каждого слоя обязательно дать покрытию высохнуть.

Нанесение

Для начала требуется правильно определиться с выбором грунтовочной смеси. Он зависит от:

  • гладкости/пористости поверхности;
  • типа финишного отделочного материала.

Совершенно неважно — стены или потолок необходимо пропитать, в этом плане разделения нет.

Процесс работы нельзя назвать сложным. Для удобства и наилучшего результата необходимо воспользоваться специальным лотком — малярной ванночкой, куда следует перелить часть строительной пропитки. Валик, смоченный в составе, раскатывается по ванночке, отжимая излишки. Это обязательное условие, чтобы во время обработки жидкая смесь не стекала с поверхности.

Популярные грунтовки

Грунтовочная смесь подразделяется на 3 типа:

  • краска;
  • средство глубокого проникновения;
  • бетон-контакт.

Краска используется на гладком и ровном основании. Для пористых, шероховатых и хорошо впитываемых влагу мест применяют покрытия глубокого проникновения. Бетон-контакт наносится под декоративную штукатурку.

Для бетона, кирпича, гипсокартона и камня подойдёт акриловая грунтовочная пропитка. Для деревянных и металлических оснований — алкидная. Силикатной обрабатывают кирпич и наружную штукатурку.

Лидерами продаж являются Ceresit CT 17, Tiefgrund LF D 14, Bindo Base, Acton, Opti Grund E.L.F.

Когда можно проводить покраску, поклейку

После нанесения состава, стены и потолок должны полностью просохнуть. В этот промежуток нужно приостановить все ремонтные работы, чтобы поверхность оставалась чистой. Время высыхания зависит от типа основания, влажности и температуры помещения, иногда на это уходит 4 часа, а иногда целые сутки. Если место, на которое нанесено средство, уже не прилипает к рукам — пора отделывать его облицовочными материалами.

Грунтовка необходима для качественного ремонта и долговечности результата. Пренебрежение этой процедурой приведет к дефектам и недостаткам поверхности, которые после окончательной отделки станут заметны невооруженным глазом.
Помимо идеального внешнего вида стены и потолок усилят свои прочностные характеристики, на них не появится плесень.

Полезное видео

Как развести грунтовку своими руками?

Большинство грунтовочных смесей продаются уже готовыми к применению. Достаточно хорошенько размешать и можно наносить. Грунтовку концентрат, возможно, потребуется разбавить. Ряд продукции представлен в виде сухого грунта, который перед работой потребуется развести. Как и чем это сделать?

Чтобы ответить на этот вопрос, надо знать состав веществ смеси, а также какой именно растворитель (разбавитель) следует использовать. Например, водно-дисперсионная смесь обычно разбавляется водой. В остальных случаях используется определенный органический растворитель. Выбор разбавителя также может зависеть от типа основания. Кстати, для работы по сильно пористым поверхностям концентрат практически никогда не разбавляют.

Важно знать: какую грунтовку чем разводитьк содержанию ↑

Зачем нужно грунтовать поверхность

  1. На прогрунтованную поверхность последующие отделочные материалы ложатся более качественно.
  2. Грунт продлевает срок службы покрытия.
  3. Глубокопроникающая грунтовочная масса может отрегулировать пористость основы, укрепить ее.
  4. После проникновения грунтовка препятствует износу материала, защищает от коррозии.
  5. Маскировка мелких дефектов.
  6. Грунтовочные смеси под покраску, шпаклевку, лакировку значительно сокращают расход отделочных материалов.
к содержанию ↑

Что использовать в качестве разбавителя

Грунтовки различаются по составу, свойствам, применению. При этом все они поделены на два типа – укрепляющие и повышающие сцепление (адгезию).

  1. Акриловая называется также дисперсионной или эмульсионной. Можно сказать, что она универсальная, так как применяется практически для всех типов поверхностей стен, полов, потолка, но не используется по металлу, так как не обладает антикоррозийными свойствами. Акриловый концентрат можно разбавить водой. Вещество нетоксично, не имеет запаха. Акриловой может быть и сцепляющая грунтовка, и глубокого проникновения.
  2. Алкидная применяется больше для подготовки деревянных стен, полов и других оснований к дальнейшей покраске. За счет глубокого проникновения и разрыхления верхнего слоя дерева, грунтовочная смесь обеспечит лучшую адгезию основания и краски. Применяется под эмаль и для работ по металлу. Но не рекомендовано использовать для стен из камня, бетона и других минералов. Сюда также входят антикоррозийные алкидные смеси с модификатором ржавчины. Концентрат можно снизить аналогичным органическим растворителем, что и в составе смеси, или использовать уайт-спирит, ксилол, сольвент, их смеси.

    Алкидная грунтовка больше подходит для металла, чем для камня, бетона и т.п.

  3. Эпоксидная и полиуретановая используются для обработки бетонного основания стен, полов, потолка, под эмаль. Также отдельные смеси предназначены для работы по металлу (против ржавчины) с последующим покрытием эмалью. Для упрощения нанесения и удлинения времени начала полимеризации, как растворитель, подходит ксилол (5-10% от объема) или другая универсальная жидкость.
  4. Полистирольная используется для стен – по штукатурке и дереву. Вещество токсично. Требует соблюдения мер индивидуальной защиты, а также хорошей продуваемости помещений во время работы и в период высыхания. Безопаснее всего использовать в промежуточной отделке наружных стен постройки.
  5. Грунтовки для работ по металлу вообще выделены в отдельную группу. В составе могут содержаться различные вещества, отвечающие за особенные свойства материала: изоляция, протекция, преобразование. Концентрат разбавляется различными растворителями до 10% от общего объема, но только не водой. В основном используются типы «родных» органических растворителей или универсальный. Грунтование металлических конструкций в несколько слоев обязательно под эмаль, покраску и в условиях постоянной влажности.
    • изолирующие, уберегающие от проникновения влаги и образования ржавчины, – глифталевые, фенолформальдегидные составы. Образуют прочную, водонепроницаемую пленку;
    • протекторные (пассивирующие) – делают железо невосприимчивым к влиянию агрессивных сред, то есть увеличивают его изоляцию;
    • преобразующие – переводят ржавчину в труднорастворимое или быстро разрушаемое соединение, увеличивают адгезивные свойства материалов.
  1. Перхлорвиниловая предназначена для обработки наружных стен из бетона и кирпича. Обычно такие составы имеют нормальную рабочую консистенцию. В составе присутствует органический растворитель (ксилол или сольвент), им же и разбавляется, если уж слишком вязкая.

Разбавленная, грунтовочная смесь лучше ложится, быстрее схватывается. Тем не менее, глубокопроникающая лучше себя проявляет как раз в неразбавленном виде.

Специалисты рекомендуют при выполнении промежуточных строительно-ремонтных работ непременно производить грунтование. В свою очередь производители строительных смесей побеспокоились о том, чтобы клиент смог беспроблемно использовать материал, снабдив упаковку инструкцией по применению.

Как разводить грунтовку для стен под покраску

Покраска стен является одним из самых популярных видов отделки помещений. Чтобы не приходилось ремонт делать ежегодно, нужно сделать так, чтобы покрытие хорошо держалось и сохраняло свежий первозданный вид. Именно для этого перед покраской проводят грунтовку стен.

Зачем грунтуют поверхность?

Основной задачей грунтовки является подготовка поверхности стены к дальнейшему нанесению различных отделочных материалов, в том числе лакокрасочного покрытия.

[ro-youtube-content count=”1″ no-desc=”0″]Как разводить грунтовку для стен под покраску[/ro-youtube-content]
  1. Грунтование позволяет существенно экономить на краске, поскольку за счет улучшения адгезионных свойств поверхности, ее расход заметно уменьшается.
  2. Грунтовка для стен под покраску (цена может быть разной) увеличивает прочность поверхности и защищает ее от влаги.
  3. Грунтование позволяет избежать появления грибка, плесени и прочих вредоносных бактерий, что, конечно же, является неоспоримым плюсом. Обработка стен не только поможет это предотвратить, но и избавит от уже существующей проблемы.
  4. Грунтовка сможет защитить поверхность от проявления пятен.

Какую грунтовку выбрать для стен под покраску?

Ассортимент подобной продукции велик. Сегодня современные производители предлагают своим покупателям самые различные грунтовки для стен под покраску, отличающиеся своими характеристиками и предназначением.

В зависимости от того, какова область применения состава, можно выделить несколько разновидностей:

  • Алкидные грунтовки для стен под покраску. Они используются в основном для обработки деревянных оснований или металлических конструкций.
  • Акриловые составы. Это универсальный материал, поэтому подходит для обработки любой поверхности. Такой вид грунтовки способен проникать на 1 см вглубь. Поэтому он используется для глубокого пропитывания основания.
  • Алюминиевые. Можно использовать только для деревянных поверхностей. Такие составы полностью защищают древесину от попадания влаги, предотвращая появление плесени и грибков.
  • Поливинилацетатные грунтовки для стен под покраску. Используются перед окрашиванием определенными видами краски, а также для бетонных, деревянных или оштукатуренных поверхностей.
  • Силикатные составы. Можно применять для обработки кирпичных стен, бетонных поверхностей либо декоративной штукатурки. Такая грунтовка глубоко впитывается в поры и трещины основания, закупоривая их.
  • Эпоксидные. Используются внутри помещений для покрытия бетонных стен.

Какая грунтовка лучше?

Выбирая то, какая грунтовка под покраску стен лучше, прежде всего рекомендуется определиться с тем, какой тип поверхности будет обрабатываться, поскольку покупка не того состава может покрытию навредить. При этом важно читать инструкцию к товару. При необходимости можно проконсультироваться с продавцом, который поможет подобрать наиболее подходящий вариант. Чем можно заменить грунтовку для стен перед поклейкой обоев?

Кроме того, желательно обратить внимание на производителя товара, стоимость материала и его технические характеристики. Чем уровень проникновения грунтовки в основание глубже, тем лучше.

Грунтовка для стен под покраску водоэмульсионной краской. Отзывы о составах

Водоэмульсионная краска считается самым безвредным и быстросохнущим видом покрытий. Она может иметь любую расцветку, которая получается путем добавления в белую массу красящих пигментов.

Под водоэмульсионную краску в основном используют акриловую или полимерную грунтовку.

Полимерная

грунтовка

Полимерная основа включает в себя поливиниловую дисперсию, кварцевый песок, мраморную и доломитовую муку. Этот вид грунтовки для стен под покраску водоэмульсионной краской не содержит в составе вредных и летучих веществ. Кроме того, он имеет высокие защитные свойства.

Среди недостатков можно выделить небольшой срок эксплуатации и при приготовлении достаточно большое образование пены.

Грунтовка акриловая

Такая грунтовка считается самой распространенной и универсальной. Она используется при разных подготовительных работах и конечной отделке поверхностей, в том числе и под покраску водоэмульсионной краской. Она подходит для обработки следующих поверхностей:

  • штукатурки;
  • кирпичных оснований;
  • пористой минеральной поверхности;
  • оснований, покрытых гипсокартоном.

Отделка поверхностей акриловой грунтовкой позволит качественно нанести краску и равномерно распределить ее. Стоимость шпаклевания стен под покраску за квадратный метр? Однако важно учитывать, что такой раствор применять для обработки гладкой и глянцевой поверхности нельзя.

Кроме того, если на материале была плесень или грибок, то перед обработкой акриловым раствором, необходимо обязательно обработать основание антибактериальной смесью.

Перед работой акриловую грунтовку можно разбавить водой в соотношении 1:3 Помните, что обработка должна проводиться только на чистой и сухой стене.

Разновидности акриловой грунтовки

Акриловые грунтовки в свою очередь классифицируются в зависимости от назначения грунтования и условий применения.

  1. Глубокого проникновения. Такое средство способно проникать вглубь основания почти на 10 см, при этом выравнивая его. Это обеспечивает минимальный расход краски.
  2. Универсальная. Средство повышает адгезию, значительно улучшает пропитку и обладает высокой влагостойкостью.
  3. Пропитывающая грунтовка для стен под покраску водоэмульсионной краской.
  4. Специальная. Применяется в особых случаях, например, для повышения стойкости поверхности к плесени и грибкам. Также, специальной грунтовкой можно обрабатывать поверхности из металла, чтобы улучшить стойкость к коррозии. Под водоэмульсионную краску такие составы применяются редко.
  5. Адгезионная. Улучшает сцепление поверхности с отделочным материалом. Чаще всего используется на плохо впитывающих и шероховатых основаниях.

Подготовка к покраске и необходимые инструменты

Способ нанесения грунтовки универсален и не отличается от нанесения иных отделочных материалов. Перед применением состава поверхность необходимо хорошо очистить от старого покрытия, зачистить, отшлифовать и обезжирить. Количество слоев грунтовки индивидуально, но не менее 2 раз. Для нанесения покрытия понадобятся следующие инструменты:

  • емкость;
  • кисточка;
  • валик;
  • пульверизатор.

Для каждого отдельного случая и определенной задачи могут понадобиться разные инструменты. Например, на кирпичную стену наносить состав удобнее при помощи кисточки, а для ровной поверхности или для стен из гипсокартона лучше всего использовать валик. Пульверизатор – тоже отличный инструмент для грунтования, но применяется он гораздо реже, поскольку после обработки помещение сложно отмыть.

Как происходит грунтование стен под покраску

Грунтование поверхности перед окрашиванием (водоэмульсионной либо любой другой краской) – обязательный этап. Лучше всего для такого вида работ использовать универсальный состав. Такой вид грунтовки имеет все необходимые свойства и отлично подходит для обработки любых поверхностей.

Грунтовка для стен под покраску (цена может быть разной) наносится в определенной последовательности:

  • наносится на поверхность первый слой;
  • основание шпаклюется;
  • наносится второй слой грунтовки.

В поддон наливают немного раствора. Валик прокатывают по емкости, все излишки состава убирают. Работа должна выполняться аккуратно. Чем отличаются шпаклевка стен под покраску от шпаклевки стен под обои?

Расход грунтовки рассчитывают следующим образом: на 1 м 2 понадобится 150 мл. После того как будет нанесен слой, желательно подождать 30-40 минут, чтобы понять уровень впитываемости поверхности, а также сколько слоев необходимо сделать.

Окрашивание стен водоэмульсионной краской можно начинать только после полного высыхания состава.

Дополнительная информация:
[ro-youtube-related]Как разводить грунтовку для стен под покраску[/ro-youtube-related]

Разбавляют смеси для грунтования, чтобы они лучше ложились на поверхность и быстрее высыхали. Разводить грунты нужно практически всех видов, кроме глубоко проникающих составов, которые гораздо лучше проявляют себя, и работать с которыми намного легче в оригинальном, не разбавленном состоянии.

Если грунтовка концентрированная, что делается для удобства транспортировки, то разбавлять ее не только можно, но и нужно, делается это в пропорции указанной на упаковке. Для обычной грунтовки все зависит от производителя и обрабатываемой поверхности.

Чтобы ответить на этот вопрос, надо знать состав веществ смеси, а также какой именно растворитель (разбавитель) следует использовать. Например, водно-дисперсионная смесь обычно разбавляется водой. В остальных случаях используется определенный органический растворитель. Выбор разбавителя также может зависеть от типа основания.

Кстати, для работы по сильно пористым поверхностям концентрат практически никогда не разбавляют.

Подготовку и покраску автомобиля нужно проводить в специально оборудованном помещении с исправно функционирующей системой вентиляции, поскольку пары грунтовочных составов вредны для органов дыхания человека. Для предупреждения брака и появления других дефектов окрашивания все работы стоит осуществлять при хорошем освещении.

Важно знать, как правильно подготовить плоскость под штукатурку или шпаклевку. Грунтовка оказывает антисептическое, обезжиривающее и противогрибковое воздействие на бетон, поэтому применять ее нужно в обязательном порядке. Главная особенность применения смеси состоит в том, чтобы каждый последующий слой штукатурки был обработан и полностью высушен.

Для штукатурки и шпаклевки применяется акриловая грунтовка – она наиболее уместна в данном типе работ.

Грунтующие материалы состоят из пленкообразующих веществ различного происхождения: натуральных и синтетических олиф, алкидных, мочевиноформальдегидных, эпоксидных и прочих смол, силиконовых и акриловых латексов, полимерных дисперсий и клеевых составов, разведенных в воде или растворителе. Кроме того, в их состав входят пигменты, но в гораздо меньших количествах, нежели в лакокрасочных материалах.

Большинство людей, которые планируют провести ремонтные работы, задаются вполне логичным вопросом: зачем проводить грунтовку под покраску? Задача данной строительной смеси заключается в том, чтобы подготовить поверхность к дальнейшему нанесению на нее краски.

Наносить грунтовку необходимо равномерно по всей площади стеновой поверхности, прокрашивая все углы помещения. Обратите внимание на участки стены, где проводились дополнительные работы по укреплению стеновой поверхности. Их необходимо прокрасить с самого начала отдельно и дать время на просыхание.

И только после этого можно грунтовать всю стеновую поверхность.

Грунтовка – это основа, которая используется в любых отделочных работах. Она необходима для того чтобы убрать с поверхности пыль и снизить впитывающую способность. Если стена оштукатурена цементным раствором с добавлением большого количества песка (так раньше строили дома хрущевки и сталинки), то в таком случае обязательно нужно обработать поверхность грунтовочной смесью.

Это поможет в дальнейшем использовать меньшее количество клея при оклеивании стен обоями или краски. Помимо этого, нанесение грунтовки на поверхность поможет увеличить адгезию, повысить износостойкость поверхности и если это необходимо – водостойкость. Специальная грунтовочная смесь будет надежно защищать стены и потолки долгие годы.

Что такое левкас и как он используется в живописи?

Вы, наверное, пришли сюда, чтобы узнать, для чего используется левкас и как его правильно использовать. Это не удивительно. Существует так много вводящей в заблуждение информации о роли левкаса в акриловой и масляной живописи. Сегодня вы узнаете, из чего на самом деле сделан левкас, несколько веских причин для его использования и историческое значение современной левкасной краски в качестве грунтовки!

Используется для Gesso

Независимо от того, какую форму или марку вы используете, левкас всегда предназначен для использования в качестве стабильного грунта для рисования.Это особый слой между вашей опорой и вашим рисунком. Неважно, используете ли вы акриловые или масляные краски, левкас считается слоем краски, поверх которого удобно рисовать. Мы можем назвать этот слой грунтовкой или грунтовкой .

Современный левкас, который вы обычно можете найти в магазине художественных товаров, сделан из акриловой краски и на самом деле должен называться acrylic gesso . Если не указано иное, что-либо, называемое «левкасом» в этой статье, относится к акриловому гипсу.

Состав акрилового гипса и их назначение

Акриловый левкас изготавливается из:

  • Акриловая полимерная эмульсия (пластичная смола, суспендированная в воде)
  • Диоксид титана (белый пигмент)
  • Карбонат кальция (мел)

Акрил — это действительно сложный коктейль химикатов, которые при высыхании превращаются в пластиковую пленку. Диоксид титана делает акриловый гипс исключительно белым и непрозрачным. Наконец, добавляется карбонат кальция (мел), чтобы грунтовка для левкаса имела матовую поверхность, абсорбирующую поверхность и достаточную шероховатость (шероховатость), чтобы краска могла соскользнуть с кисти.

Как разбавить левкас

Поскольку левкас растворим в воде, его можно разбавить водой. Только по этой причине акриловый левкас и акрил в целом стали действительно популярным выбором для современных художников. При разбавлении левкаса добавляйте время от времени немного воды и тщательно перемешивайте. Легко добавить слишком много воды и сделать левкас слишком водянистым.

Насколько тонким должен быть ваш левкас?

Я видел, как многие лепешки выходили из контейнера с идеальной консистенцией, готовые к использованию, в то время как другие были готовы к использованию, поэтому считали, что их нужно сильно разбавить.Большинству художников нравится, чтобы левкас имел консистенцию «жирных сливок». Достаточно жидкий, чтобы налить, но совсем не вязкость воды. Если ваш левкас слишком толстый, вы получите текстуру мазка кисти.

Где найти акриловый гипс

Любой современный контейнер, на котором написано «левкас», относится к разновидности акрилового левкаса. Он быстро стал наиболее широко используемым грунтом для рисования как акриловыми, так и масляными красками. Это действительно недорого, очень легко наносится, очень быстро сохнет и очень легко очищается.Все основные компании, занимающиеся акриловой и масляной живописью, производят акриловый левкас.

Если вы все еще не уверены, сделан ли контейнер из акрилового гипса, просто поищите ингредиенты. Любой достойный продукт для покраски с гордостью перечислит информацию о том, что находится в контейнере.

Загрунтованные холсты

При покупке предварительно загрунтованного холста или панно оно грунтуется акриловым гипсом. Как указывалось ранее, акриловый левкас, безусловно, стал наиболее широко используемой площадкой для рисования, на которую художники наносят краски.Производители часто наносят до 3 слоев гипса, чтобы получить равномерное покрытие.

Это означает, что вам не нужно ничего делать с купленными в магазине предварительно грунтованными холстами. Они уже приготовлены с левкасом!

Подготовка поверхности для покраски?

Многие художники любят растягивать собственные полотна. После растяжения можно легко прогрунтовать голый холст акриловым гипсом. Только обязательно используйте жесткую кисть и работайте быстро.

Вы можете экспериментировать с разной толщиной левкаса, однако вы обнаружите , что нанесение левкаса с консистенцией жирных сливок является предпочтительной толщиной, используемой большинством художников. .Некоторые акриловые гипсы оказываются в емкости толще, и их нужно разбавлять водой.

Как только у вас будет нужная консистенция, все, что вам нужно сделать, это нанести левкас на голый натянутый холст с помощью большой кисти с жесткой щетиной.

Избегайте использования очень дешевых щеток с «чипами», которые вы можете купить в магазинах товаров для дома примерно за 1,20 доллара. В противном случае расческа не единственное, что теряет волосы на протяжении всего процесса!

Этапы создания холста:
  1. Смешать левкас до нужной консистенции. (использовать воду и только при необходимости)
  2. Быстро нанесите тонкий слой левкаса из одной стороны в другую, пока полотно не будет полностью покрыто. Жесткость щетинок необходима для того, чтобы весь левкас проник в трещины волокон полотна.
  3. Вытрите кисть и проведите кистью взад и вперед по поверхности, чтобы лопнуть пузырьки и равномерно нанести краску. Кисть должна быть перпендикулярна полотну и едва касаться.Для оптимальной ровности используйте штриховку.
  4. После высыхания слегка отшлифовать наждачной бумагой.
  5. Повторяйте шаги 1–4, пока не получите желаемую поверхность.

Заманчиво добавить сразу тонну левкаса, но вы получите гораздо лучшую поверхность, если раскрасите ее тонкими слоями, зашкурив между . Чем больше слоев гипса вы завершите, тем более гладким становится холст. Повторите процесс грунтования + шлифования достаточно, и вы получите настолько гладкую поверхность, что вы больше не сможете сказать, что левкас поддерживается холстом! Но если вам нужна полностью гладкая поверхность, вам нужно просто работать с панелью.

Заманчиво отшлифовать левкас, когда он высохнет на ощупь. Лучше всего дать гипсу высохнуть на ночь. Акриловые краски, такие как акриловый гипс, могут быть сухими на ощупь, но будут липкими, если вы попытаетесь их отшлифовать. Просто будьте терпеливы!

Грунтовка панели с помощью Gesso

Если вы хотите рисовать на панели, вы сразу же будете готовы рисовать, используя акриловый гипс. Один или два слоя — это все, что вам нужно для подготовки поверхности к покраске.Обратите внимание, что практически невозможно сохранить гладкую поверхность, если вы наносите левкас кистью.

Для получения наиболее гладких результатов используйте малярный валик с гладким ворсом, а для еще более гладких результатов вы можете распылением нанести гипс!

Прежде чем взять один из этих больших малярных валиков, предназначенных для покраски стен, подумайте еще раз. Большинство из этих роликовых труб имеют ворс дюйма или 3/8 дюйма. В результате на вашей панели появится текстура апельсиновой корки.

Внимательно посмотрите на окрашенные стены в вашем доме при хорошем освещении, и вы увидите текстуру, о которой я говорю. Для получения максимально гладкого результата при грунтовании панели используйте 6-дюймовый валик из вспененного материала без ворса.

Вы можете слегка отшлифовать панель, чтобы убедиться, что у левкаса достаточно зубцов, за которые можно зацепиться. Это особенно характерно для твердых супергладких поверхностей некоторых плит Masonite и закаленных древесноволокнистых плит.

Этапы создания панели:
  1. Слегка отшлифуйте поверхность панели. (зернистость 200+, иначе появятся царапины)
  2. Очистите поверхность от пыли влажной безворсовой тканью.
  3. Смешать левкас до нужной консистенции. (использовать воду и только при необходимости)
  4. Равномерно раскатать левкас на столе.
  5. После высыхания слегка отшлифовать наждачной бумагой.
  6. Повторите шаги 1–4 еще раз для получения ярко-белой поверхности.
Устранение неполадок при заливке

Вот некоторые общие проблемы, которые могут возникнуть при нанесении левкаса на холст с помощью кисти.

Проблема Решение
Волосы в земле
  • Используйте щетку лучшего качества — купите щетку за 15 долларов и просто хорошо ее почистите!
  • Волосы можно аккуратно выловить острым концом мастихина
Комки и мазки кистью
  • Левкас разбавить водой
  • Работайте быстрее, чтобы краска успела осесть
  • Слегка потрите влажную левкасную поверхность кончиком сухой кисти (движение вперед-назад)
Клейкая при шлифовании
  • Краска полностью не высохла… ждать целый день
Текстура холста показывает слишком много

Нужен ли Гессо?

Необходимость окрашивания поверхности, загрунтованной левкасом, зависит от того, какой краской вы используете.Если вы пользуетесь акриловыми красками, то левкас не нужен. Акриловая краска ни в коем случае не повредит необработанный холст. Необработанный холст, однако, действительно впитывает влагу и не слишком подходит для большинства стилей рисования кистью. Рисование на необработанном холсте похоже на рисование на скатерти. Необработанный холст впитает всю жидкость из краски и больше подходит для окрашивания, чем для проталкивания краски и растушевки.

Таким образом, художникам по акрилу не обязательно использовать левкас, но они, вероятно, захотят.

Масляным художникам абсолютно необходимо создать своего рода барьер между масляными красками и холстом.Если масло попадет на необработанный холст, холст со временем станет хрупким и со временем развалится. Многие художники называют это гниением холста.

Многие художники, работающие маслом, преодолевают склонность масляных красок к гниению холста, грунтовав холст акриловым гипсом. Акриловый левкас создает барьер между холстом и масляными красками и средствами масляной живописи.

Теперь вы можете подумать … Масляная живопись существует уже сотни лет, а акрил коммерчески доступен только с 1950-х годов … Как масляные художники защищали свои холсты от порчи до изобретения акрилового гипса?

Краткая история грунтовок на масляной основе

Акриловый левкас получил свое название от итальянского слова «мел» или «гипс» и на самом деле вовсе не настоящий левкас в историческом смысле.Этот аутентичный левкас, который использовали классические итальянские художники, был сделан из связующего вещества животных, такого как клей для кожи кролика, и различных отбеливающих веществ, таких как мел, штукатурка или даже мраморная пыль.

Многие из этих старых методов изготовления холстов и панно до сих пор используются ведущими мировыми художниками-масляными художниками и убежденными любителями.

Если вы покупаете высококачественный холст для рисования, вы обязательно встретите холст, грунтованный маслом. Эти полотна часто изготавливаются из льна, а иногда и из хлопка.Холсты с масляной грунтовкой не грунтовать акриловым гипсом. Они заправлены формулой на масляной основе. Представьте себе масляную грунтовку, как акриловый гипс, содержащий диоксид титана (белый пигмент) и карбонат кальция (мел), но со связующим, представляющим собой масляную среду, а не акриловую смолу.

Многие производители масляных красок сейчас продают масляные грунтовки, и их рецепты действительно различаются. Многие из них вводят алкидную смолу в связующую масло часть грунтовки в качестве осушителя.

Размер холста

Если вы работаете с масляной грунтовкой, вам следует сначала измерить размер холста, чтобы защитить масляную грунтовку от прямого контакта с необработанными волокнами холста.Традиционно для этого использовался кожный клей из кожи кролика. Я сделал это с нуля в колледже и могу сказать вам, что от этого дурно воняет.

Поскольку мы не хотим навредить очаровательным кроликам, а также потому, что консерваторы рекомендуют более гибкие, современные заменители, такие как ПВА, если вы не фальсификатор произведений искусства, от клея для кроличьей шкуры больше нет особого смысла. Используйте качественный клей ПВА, чтобы запечатать и защитить холст перед нанесением масляной грунтовки.

Acrylic Gesso vs.Масляные грунтовки

Интернет кажется благодатной почвой для художников-любителей, которые любят спорить о мелочах. Вы можете часами, днями или даже неделями читать все рекомендации головорезов о том, что метод одного старого мастера — единственный способ сделать все остальные плохими. (вот смотрит на вас мокрый холст). Вы можете напугаться и запутаться в принципах «жир-над-худой», так напугать и сбить с толку, что на самом деле вы проводите все свое время за чтением глупых форумов, вместо того чтобы рисовать!

Не беспокойтесь об этом слишком много.Я рекомендую учиться немного по ходу дела и, ради бога, не зацикливаться на мелочах. Просто продолжайте рисовать и учиться у лучших инструкторов, которых вы можете найти. Изучение материалов очень важно, но вместе с тем становится все лучше и больше в навыках рисования.

Лично мне нравится ощущение грунтованной маслом поверхности под моими кистями, а акриловый гипс кажется слишком впитывающим для моих методов рисования. Хотя мне нравится работать с льняными холстами, загрунтованными маслом, это не значит, что я рекомендую эту установку для начинающих художников. Моя установка действительно дорогая по сравнению с акриловым гипсом на хлопковом холсте и требует гораздо большей подготовки, опыта и времени сушки.

Нанесение масляной грунтовки

Хотя в этой статье основное внимание уделяется современному акриловому гипсу, я подумал, что хотел бы упомянуть некоторые полезные методы нанесения грунтовок на масляной основе, поскольку их действительно легко наносить кистью, как и акриловый гипс. Посмотрите видео ниже, в котором объясняется, как затереть масляную грунтовку и выровнять поверхность.Опять же, если вы все еще учитесь рисовать, не беспокойтесь обо всем этом. Просто пока придерживайтесь предварительно загрунтованных полотен.

Заключение

  • Акриловый левкас, хотя и не настоящий левкас , используемый нашими предками масляной живописи, является отличным грунтом для рисования любым материалом для рисования. Хотя обычно это белый цвет, компании проявили творческий подход к своим левкасам и теперь предлагают черный левкас, прозрачный левкас и т. Д. Вы даже можете слегка подкрасить левкас акриловой краской, если вы предпочитаете работать на не чисто-белом фоне. .
  • Если вы только начинаете, не связывайтесь со сложными и дорогими грунтовками для масляной живописи, просто используйте качественный акриловый левкас и потратьте свои усилия на улучшение своих навыков рисования.
  • Вы можете сделать холст более гладким, нанося последующие слои гипса, давая каждому слою высохнуть в течение ночи и слегка шлифуя между нанесениями.
  • Gesso можно разбавлять водой до желаемой консистенции, наносить кистью, валиком или распылять. Поскольку это водорастворимая очистка, это совсем несложно!
  • Поскольку акриловые продукты сохнут очень быстро, вы должны работать быстро и завершить процесс грунтования за один непрерывный период времени.

Я оставлю вам двухминутное видео от Liquitex, производителя всех видов гипсовых плиток / оснований, на которых можно рисовать!

Ознакомьтесь с этими статьями по теме.
.

20 способов решения проблемы загрязнения воды

Загрязнение воды происходит, когда в водоем попадают токсичные и вредные соединения. Этот водоем включает реку, океан или любой другой источник воды. Загрязнение воды — серьезная проблема, поскольку оно оказывает негативное воздействие как на людей, так и на окружающую среду. Это может вызвать болезнь и необратимое загрязнение источника чистой воды. В этой статье представлены 20 способов решения проблемы загрязнения воды. Эти решения могут помочь снизить интенсивность загрязнения воды.

Также прочтите:

1. Избегайте сброса отходов в реки

Эффективный способ решить проблему загрязнения воды — избегать сброса отходов в реки. Сюда входят как твердые, так и жидкие отходы. Отходы содержат много материалов с вредными химическими веществами, которые могут испортить качество воды в реке. Чем больше отходов в реках, тем токсичнее становится вода. Загрязнение продолжит распространяться на другие водоемы, когда люди по-прежнему сбрасывают отходы в реку.Когда сброс отходов прекратится, вода снова начнет постепенно улучшаться.

2. Используйте натуральные удобрения

Возможно, вам понадобится использовать удобрения или пестициды для сада дома. Но у этого есть и обратная сторона: эти вещи содержат токсичные химические вещества, которые могут попасть в источники воды. В конечном итоге вода может сильно загрязниться. Всегда лучше использовать натуральные удобрения или пестициды, которые можно купить у местных фермеров.Компостирование также может быть альтернативой химическим удобрениям, которые могут представлять меньшую угрозу для качества воды.

Также прочтите: Угрозы морским млекопитающим

3. Очистка рек

Реки могут быстро испачкаться, если люди продолжают сбрасывать в них отходы. Прежде чем весь мусор начнет скапливаться, рекомендуется начать очистку рек. Очистка рек может помочь увеличить количество токсичных веществ, отравляющих воду. Очистка может быть в форме непосредственного удаления отходов из воды.Еще один способ помочь в уборке — собрать малейший намек на мусор вокруг реки, прежде чем больше мусора скапливается и плавает в речной воде.

4. Избегайте слива масла в раковину

Выбрасывать любое масло в раковину — плохая идея. Большая часть накопления масла возникает в результате приготовления пищи. Может быть удобно просто смыть его водой в раковине, но это способствует загрязнению воды. Нефть в конечном итоге окажется в огромном водоеме и загрязнит его.Хороший способ избавиться от масла — собрать его в контейнере, а затем выбросить вместе с мусором.

Подробнее:

5. Сократите использование машин, которым требуется вода

Многие наши бытовые приборы требуют воды для выполнения своей работы. Примерами таких устройств являются посудомоечная машина, а также стиральная машина. Обе эти машины нуждаются в большом количестве воды для работы. Лучше всего сократить использование этих машин. Для этого можно задействовать их только при полной загрузке.Это уменьшит частое использование машин. Это также означает, что меньше воды будет загрязнено мылом, которое в конечном итоге будет стекать в реки.

6. Используйте экологически чистые жидкости или порошки для стирки.

Большинство стиральных жидкостей или порошков содержат химические вещества, токсичные для воды. Когда они слишком часто используются, они могут привести к еще большему загрязнению воды. Способ решить эту проблему — использовать экологически чистые моющие жидкости или воду. Начните использовать более экологичное мыло для стирки.Они могут стоить дороже, но они не вредят окружающей среде.

Также прочтите: Разлагатели океана

7. Используйте меньше мыла для стирки

Поскольку мы уже знаем, что мыло для стирки превращает чистую воду в грязную, лучше использовать только то количество мыла, которое уже рекомендовано. по направлениям. Старайтесь не использовать больше, чем положено, чтобы уменьшить количество грязной воды. Это также может помочь уменьшить количество загрязненной воды, которую необходимо использовать для лечения.

8. Используйте меньше пластика

Пластик разлагается десятилетиями. К сожалению, это один из наиболее часто используемых материалов во многих предметах домашнего обихода. После того, как пластик выброшен, большая его часть оказывается где-то в воде. Когда пластик начинает разлагаться, в воду попадают вредные и токсичные химические вещества. Вода начинает загрязняться. Использование меньшего количества пластика может уменьшить количество пластиковых отходов в воде. Это означает более чистую и здоровую воду.

Подробнее:

9. Избегайте выбрасывать предметы в туалеты

Туалетную бумагу можно выбрасывать в туалете, поскольку она изготовлена ​​из материалов, которые могут безопасно распадаться при контакте с водой. Чего следует избегать, так это выбрасывать такие предметы, как лекарства, такие как таблетки. Хотя они могут казаться маленькими, химические вещества могут растворяться в воде. Неиспользованные лекарства лучше всего выбросить в специальный мусор.

10. Техническое обслуживание автомобиля

Забота о вашем личном автомобиле — важный аспект уменьшения загрязнения воды.Вода — это элемент, на который влияет состояние воздуха в окружающей среде. Когда автомобиль не проверяется регулярно, высока вероятность того, что он будет выделять больше вредного газа. Газ выйдет в воздух. Воздух загрязняется, и это влияет на общее качество воды вокруг него.

Также прочтите: Влияние океанских течений на климат

11. Увеличение количества растений вокруг дома

Посадка большого количества растений или деревьев вокруг дома — это способ помочь решить проблему загрязнения воды.Чем больше они будут выращиваться, тем лучше. Деревья и другие растения могут помочь в фильтрации воды под землей. Более того, если в воде, текущей вокруг дома, присутствует вредная жидкость, эти деревья и растения могут помочь остановить сток жидкости в близлежащие источники чистой воды.

12. Уборка района

Иногда мусор или мусор могут скапливаться вокруг домов или окрестностей. Если мусор не выбросить должным образом, он может вызвать распространение вредных химических веществ в источники чистой воды.Например, когда идет дождь, вода уносит разлагающиеся материалы, которые могут попасть в реки. Чтобы этого не произошло, нужно регулярно убирать окрестности. Убедитесь, что вокруг нет мусора, который может превратиться в вредный мусор.

Подробнее:

13. Обучайте друзей и членов семьи

Еще один хороший шаг к устранению загрязнения воды — повышение осведомленности. Начните рассказывать друзьям, членам семьи или кому-либо еще о важности качества воды.Расскажите им, как загрязнение воды может оказать долгосрочное негативное воздействие на людей, а также на окружающую среду. Когда все больше людей начнут беспокоиться об этой проблеме, можно будет внести большой вклад в поддержание чистоты воды.

14. Взаимодействуйте с организациями

Начните сотрудничать с организациями по вопросам благополучия окружающей среды. Организации не обязательно уделять особое внимание качеству воды. Это может быть организация, занимающаяся переработкой отходов или другими видами обращения с отходами.В конце концов, огромная причина загрязнения воды — плохое управление отходами. Когда вы работаете в организации, вы можете достичь большего с участием многих людей с одной и той же миссией.

Также прочтите: Виды китов, находящиеся под угрозой исчезновения

15. Требовать от правительства более эффективного регулирования

Правительство имеет больше полномочий, когда дело доходит до принятия нормативных актов. Подайте петицию или потребуйте от правительства большего внимания к лучшему регулированию качества воды.Когда вмешается правительство, могут быть сформированы новые или более строгие правила для поддержания хорошего качества воды.

Подробнее:

Другие способы решения проблемы загрязнения воды (16-20)

Вот список других способов решения проблемы загрязнения воды, которые также важны:

  • Повторное использование пластика: Помимо сокращения использования пластик, повторное использование пластиковых предметов, которые были куплены, может во многом помочь решить проблему загрязнения воды. При повторном использовании меньшее количество пластиковых изделий попадет в реки.
  • Очистка септика: Септик следует регулярно чистить или обслуживать во избежание утечки. Утечка приведет к загрязнению близлежащего источника воды отходами жизнедеятельности человека.
  • Лучшее управление отходами в промышленности: Требование более эффективного управления отходами в промышленности может помочь снизить загрязнение воды. Некоторые отрасли промышленности позволяют своим химическим веществам попадать прямо в реки. Им необходимо уменьшить количество токсичных стоков, которые они вызывают.
  • Утилизируйте автомобильное масло отдельно: Выполняя техническое обслуживание автомобиля в домашних условиях, обязательно выбрасывайте автомобильное масло или жидкость в специальный мусор.Не позволяйте маслу стекать в сточные канавы или землю.
  • Не замусоривать пляж: Избегайте замусоривания на пляже. Носите с собой любые отходы и выбрасывайте их, как только найдете мусорный бак. Засорение приведет к скоплению мусора в океане. Океан — это самый большой водоем в мире, который никогда не должен загрязняться.

Узнайте больше:

Эти 20 способов решения проблемы загрязнения воды никогда не сработают, если люди не осознают, насколько серьезна эта проблема.Люди должны понимать, что каждый день мы вносим огромный вклад в загрязнение воды, и это нужно остановить. Эти решения не будут эффективными, если люди не начнут действовать. Малейшее действие может помочь решить проблему загрязнения воды.

.

11 способов воздействия человека на окружающую среду

Мы, люди, стали зависимыми от предметов роскоши, таких как автомобили, дома и даже наши мобильные телефоны. Но как наша любовь к промышленным изделиям из металла и пластика влияет на окружающую среду? Такие вещи, как чрезмерное потребление, чрезмерный вылов рыбы, вырубка лесов, сильно влияют на наш мир.

Человеческая деятельность может быть напрямую связана с причиной сотен исчезновений за последние два столетия по сравнению с миллионами лет естественного вымирания.По мере нашего продвижения в 21 веке люди изменили мир беспрецедентным образом.

Влияние человека на окружающую среду стало одной из основных тем для сотрудников университетов во всем мире. Пока они ищут ответ, общественность должна внести свой вклад. По крайней мере, нужно знать обо всех факторах, которые способствуют этому состоянию, и делиться знаниями.

1.

Перенаселение Источник : Diy13 / iStock

Выживание раньше означало повторное заселение.Это, однако, быстро становится верным для противоположного, когда мы достигаем максимальной пропускной способности, которую может выдержать наша планета.

Перенаселение переросло в эпидемию, так как уровень смертности снизился, медицина улучшилась и были внедрены методы промышленного земледелия, благодаря которым люди выживали намного дольше и увеличивалась общая численность населения.

СМОТРИ ТАКЖЕ: ЧТО ТАКОЕ ПОТЕРИ БИОРАЗНООБРАЗИЯ И ПОЧЕМУ ЭТО ПРОБЛЕМА?

Последствия перенаселения весьма серьезны, одним из самых серьезных является ухудшение состояния окружающей среды.

Людям требуется много места, будь то сельхозугодья или предприятия, которые также занимают много места. Увеличение численности населения приводит к более сплошным рубкам, что приводит к серьезному повреждению экосистем. Без достаточного количества деревьев для фильтрации воздуха уровни CO₂ возрастают, что может нанести ущерб каждому отдельному организму на Земле.

Еще одна проблема — наша зависимость от угля и ископаемого топлива в качестве источника энергии. Чем больше население, тем больше ископаемого топлива будет использоваться. Использование ископаемого топлива (например, нефти и угля) приводит к выбросу большого количества углекислого газа в воздух, что угрожает исчезновению тысяч видов, что усиливает эффект, который имеет истощение лесов уже .

Человечеству постоянно требуется больше места, что разрушает экосистемы и увеличивает уровни CO₂, еще больше разрушая хрупкую окружающую среду. Хотя обработанные материалы необходимы для обеспечения энергией городов, предыдущая оценка говорит нам, что планета может нести такой большой ущерб, пока не начнет наносить ущерб нам.

2.

Загрязнение Источник: zeljkosantrac / iStock

Загрязнение повсюду. От мусора, выброшенного на автостраде, до миллионов метрических тонн загрязняющих веществ, выбрасываемых в атмосферу каждый год , очевидно, загрязнения и отходы неизбежны.

Загрязнение настолько сильно, что на сегодняшний день 2,4 миллиарда человек не имеют доступа к источникам чистой воды. Человечество постоянно загрязняет такие незаменимые ресурсы, как воздух, вода и почва, восполнение которых требует миллионов лет.

Воздух, вероятно, является наиболее загрязненным, при этом только в США ежегодно производится 147 миллионов метрических тонн загрязняющих веществ в воздухе.

В 1950 году смог в Лос-Анджелесе был настолько сильным, что приземный озон (атмосферный газ, которого много в атмосфере, а не на земле) превышал 500 частей на миллиард объема (ppbv), что намного выше национального уровня атмосферного воздуха. Стандарт качества 75 ppbv (6.В 6 раз больше, если быть точным).

Люди думали, что они подверглись нападению со стороны иностранцев, поскольку смог обжег им глаза и оставил в воздухе запах отбеливателя. Именно тогда было обнаружено разрушительное действие аэрозолей.

В то время как качество воздуха в США немного улучшилось, качество воздуха в развивающихся странах продолжает падать, поскольку смог непрерывно закрывает солнце плотной пеленой загрязнения. Это лишь один из вопросов, который нам предстоит решить в ближайшем будущем.

3.

Глобальное потепление

Глобальное потепление, возможно, является самой большой причиной воздействия на окружающую среду.Самая большая из причин, связанных с уровнем CO₂ от дыхания до более пагубных причин, таких как сжигание ископаемого топлива и вырубка лесов.

Во всяком случае, люди постоянно повышают уровень CO₂ во всем мире — каждый год . Наивысший уровень CO₂ за всю историю до 1950 года составлял около 300 частей на миллион . Однако текущие измерения уровней CO₂ превысили 400 ч / млн, аннулировав все записи, датируемые 400000 лет .

Увеличение выбросов CO₂ способствовало повышению средней температуры планеты почти на целый градус.

По мере повышения температуры арктический наземный лед и ледники тают, что вызывает повышение уровня океана со скоростью 3,42 мм в год, позволяя большему количеству воды поглощать больше тепла, что тает больше льда, создавая петлю положительной обратной связи , вызовет повышение уровня океанов на 1-4 фута к 2100 .

Так в чем же дело?

4.

Изменение климата Источник: Sepp / iStock

Изменение климата тесно связано с историческим развитием промышленности и технологий.По мере повышения глобальных температур погодные условия на Земле резко изменятся. В то время как некоторые области будут испытывать более длительный вегетационный период, другие станут бесплодными пустошами, поскольку вода истощит на обширных территориях, превратив некогда цветочные регионы в пустыни.

Это увеличение повлияет на погодные условия, обещая более сильные ураганы как по размеру, так и по частоте, а также усиление и продление засух и волн тепла. Но загрязнение воздуха влияет не только на окружающую среду.

Растет количество свидетельств того, что плохое качество воздуха и повышение температуры разрушают хрупкие экосистемы, что даже приводит к увеличению заболеваемости астмой и раком у людей.

5.

Генетическая модификация Источник : simarik / iStock

Генетически модифицированные организмы (ГМО) внесли большой вклад в выживание и процветание людей. ГМО — это отобранные выведенные культуры или культуры, в которые непосредственно имплантирована ДНК, чтобы дать урожаю преимущество, будь то поддержание более низких температур, меньшее количество воды или получение большего количества продукции.

Но ГМО не всегда преднамеренно. В течение многих лет люди использовали глифосат, гербицид, предназначенный для уничтожения сорняков — самой большой угрозы для любого растения. Однако так же, как у людей есть обучающаяся иммунная система, некоторые сорняки выработали устойчивость к 22 из 25 известных гербицидов, при этом 249 видов сорняков полностью невосприимчивы, согласно последнему научному отчету.

«Суперсорняки» угрожают сельскохозяйственным угодьям, заглушая обнажения. Одно из единственных решений — обрабатывать землю, переворачивать почву, чтобы убить сорняки и дать раннее преимущество посеянным культурам.

Недостаток обработки почвы заключается в том, что она ускоряет высыхание почвы и уничтожает полезные бактерии, что значительно сокращает продолжительность ее плодородной жизни. Чтобы восполнить истощенную почву, используются удобрения, которые создают целый ряд новых проблем для окружающей среды и могут иметь катастрофические последствия для местного сельского хозяйства в долгосрочной перспективе.

6.

Подкисление океана

возникает, когда CO₂ растворяется в океане, связываясь с морской водой с образованием угольной кислоты.Кислота снижает уровень pH в воде, существенно изменив кислотность океана на 30% согласно анализу за последние 200 лет — уровень, на котором океан не был более 20 миллионов лет.

Кислотность снижает концентрацию кальция, из-за чего ракообразным трудно строить свой панцирь, что делает их уязвимыми без брони. Ученые говорят, что в период между повышением глобальной температуры на один градус и закислением океана четверть всех коралловых рифов считаются поврежденными, не подлежащими восстановлению, а две трети находятся под серьезной угрозой.Гибель коралловых рифов вызывает серьезную озабоченность.

Коралловые рифы являются домом для 25% водных организмов , многие из которых отвечают за естественную фильтрацию океана и производство необходимых питательных веществ, жизненно важных для жизни под водой. Однако подкисление — не единственная водная угроза, поскольку есть другие виды деятельности человека, вызывающие серьезные изменения. Такие вещи, как загрязнение пластиком и чрезмерный вылов рыбы, наносят ущерб нашим океанам.

7.

Загрязнение воды

Всего 5.25 триллионов кусков пластикового мусора в океане. В океаны попадает не только мусор, но и чрезмерное количество удобрений, которые попадают в океан из-за дождей, наводнений, ветров или сбрасываются в избытке прямо в крупнейшего производителя кислорода, который у нас есть.

Удобрение содержит азот, элемент, необходимый для роста растений, но это не ограничивает его предназначение.

Фитопланктон и водоросли питаются азотом, вызывая чрезмерный рост так называемых «красных приливов» или «коричневых приливов» в районах с высокой концентрацией азота.Коричневый прилив вызван быстрым ростом миллиардов водорослей, которые истощают водоемы кислородом и заставляют отравить все живое, которое его потребляет, включая рыбу и птиц. Но на этом загрязнение воды не заканчивается.

Год за годом миллионы тонн мусора выбрасываются в океан. Поскольку мусор в основном состоит из пластика, он не растворяется. Мусор накапливается в больших водоворотах через океан.

Морские обитатели, в том числе морские черепахи, обманываются, заставляя думать, что они едят пищу, хотя на самом деле это только плавающий пластиковый пакет или другой ядовитый пластик, который может вызвать голод или удушье для любого несчастного животного, которое по ошибке его проглотит.

8. Перелов

Загрязнение — угроза номер один для всех водных организмов и основная причина сокращения биоразнообразия. Это действительно печально, учитывая, что вода и водные формы жизни являются одними из самых важных природных ресурсов, имеющихся в нашем распоряжении. Но, как упоминалось выше, чрезмерный вылов рыбы также наносит ущерб нашим океанам.

Рыбалка по своей природе неплоха для нашего океана. Но без надлежащего регулирования это может нанести вред нашим океанам и людям. Мировые запасы перелова выросли втрое за полвека, и сегодня, по данным Всемирного фонда дикой природы, сегодня полностью треть оцененных мировых промыслов выходит за пределы своих биологических пределов.Тем более, что миллиарды людей полагаются на рыбу как на белок.

9.

Вырубка лесов Источник: luoman / iStock

По мере экспоненциального роста численности людей, с огромными темпами производится все больше продуктов питания, материалов и жилья, в основном за счет лесного хозяйства.

Леса расчищены, чтобы освободить место для новых людей, что, в свою очередь, производит больше людей, вы можете видеть проблему. Согласно международным данным, ежегодно вырубается около 18 миллионов акров деревьев, чтобы освободить место для новых разработок и изделий из древесины — это чуть менее половины всех деревьев на планете с начала промышленной революции.

Поскольку деревья являются одними из крупнейших производителей кислорода, очевидно, что это не очень хорошо для людей, и особенно для животных, которые считают лес своим домом.

Из-за того, что в лесах обитают миллионы различных видов, обезлесение является серьезной угрозой их выживанию и серьезной проблемой сохранения. Это также увеличивает количество парниковых газов в атмосфере, что приводит к дальнейшему глобальному потеплению. Если мы хотим выжить, такую ​​человеческую деятельность необходимо прекратить. Более того, недавние исследования связывают вырубку лесов с увеличением лесных пожаров в таких регионах, как Амазонка.Лесные пожары в равной степени разрушаются даже в большей степени, вытесняя как людей, так и целые виды.

10.

Кислотный дождь

Когда люди сжигают уголь, диоксид серы и оксиды азота выбрасываются в атмосферу, где они поднимаются и накапливаются в облаках, пока облака не станут насыщенными, а дождь станет кислотным, вызывая опустошение на земле.

Когда идет дождь, он накапливается в водоемах, которые особенно опасны для озер и малых водоемов. Земля вокруг воды впитывает кислоту, истощая почву необходимыми питательными веществами.Деревья, поглощающие кислоту, накапливают токсины, которые повреждают листья и медленно убивают большие участки леса.

Кислотные дожди, как известно, полностью уничтожают целые виды рыб, вызывая эффект снежного кома, наносящий ущерб экосистеме, которая зависит от различных организмов для поддержания окружающей среды.

11.

Разрушение озона Источник: nito100 / iStock

Озоновый слой известен своей способностью поглощать вредные ультрафиолетовые лучи, которые в противном случае могли бы нанести вред здоровью всех слоев общества.Без озонового слоя ходить на улицу было бы невыносимо.

Озон состоит из трех связанных атомов кислорода, которые всплывают в стратосферу, где они поглощают значительное количество УФ-излучения, защищая все живое внизу. Однако «озоноразрушающие вещества» (или ОРВ), в основном состоящие из хлора и брома, попадают в стратосферу, где они лишают O3 кислорода, разрушая его способность поглощать УФ-свет.

Воздействие человека разрушительно для растений, чрезвычайно чувствительных к ультрафиолетовому излучению, включая пшеницу и ячмень, две незаменимые культуры для человека.

Хотя большинство химикатов, разрушающих озоновый слой, были запрещены, химическим веществам, которые уже были выпущены, может потребоваться более 80 лет , чтобы достичь верхних слоев атмосферы, поэтому пройдет некоторое время, прежде чем наша защитная граница снова станет полностью функциональной . А пока нанеси солнцезащитный крем и будь там в безопасности.

В будущее

Крайне важно, чтобы мы поддерживали землю, на которой мы живем, но, несмотря ни на что, земля будет жить на ней. Человек влияет на естественную среду обитания по-разному, и мы должны осознавать свой личный вклад в окружающую среду.

Будем мы жить с этим или нет, зависит исключительно от решений и действий, которые мы предпримем дальше. Мать-природа — неумолимая, неумолимая сила, поэтому, вероятно, будет лучше, если мы будем хорошо относиться к ней, и, возможно, просто, может быть, мы сможем компенсировать ущерб, который уже был нанесен.

Лучшее время для действий было вчера, лучшее, что мы можем сделать — это сегодня, но если мы будем ждать завтра, может быть уже слишком поздно. Общество должно помочь себе, чтобы выжить.

Чтобы узнать больше о нашей окружающей среде, обязательно загляните сюда.

.

10 способов помочь уменьшить изменение климата

С увеличением количества парниковых газов и сокращением ледников угроза превращения нашей зеленой планеты в бесплодную землю в будущем кажется реальной. Повышение уровня загрязнения из-за безрассудного использования ресурсов Земли создало тревожную ситуацию для людей, населяющих планету.

Если это неправильное использование ресурсов продолжится в будущем, есть вероятность, что наша планета может оказаться среди других семи планет, где жизнь невозможна.Чтобы этого не произошло, мы, жители этой зеленой планеты, должны предпринять строгие меры, чтобы охранять уникальность нашей планеты и позволить ей всегда быть зеленой и полной жизни.

СМОТРИ ТАКЖЕ: ИЗМЕНЕНИЕ КЛИМАТА МОЖЕТ СТАТЬ «ТОЧКОЙ НЕ ВОЗВРАТА» В 2035 г. ПРЕДУПРЕЖДЕНИЕ УЧЕНЫХ

Итак, что вы могли бы сделать для защиты окружающей среды на индивидуальном уровне? Чтобы решить вашу дилемму, мы составили список из десяти вещей, которые вы можете сделать, чтобы спасти и защитить наш дом.

1. Скажи пластику нет Источник: Pxhere

Пластик или полиэтилен, несомненно, вредны не только для здоровья людей, но и для здоровья биоразнообразия.Запрет использования пластика в окружающей среде автоматически снизит уровень загрязнения в несколько раз.

Но учитывая обилие пластика в каждом уголке нашей жизни, задача кажется нереальной. Но некоторые маленькие шаги могут значительно уменьшить количество пластикового загрязнения в нашей жизни.

Это:

  • Использование перерабатываемого тканевого мешка.
  • Выбросить пластиковые бутылки и использовать бутылки из стекла, глины, нержавеющей стали или меди.
  • Замените пластиковые ланчбоксы на стальные

2.

Солнце спешит на помощь Источник : Tiia Monto / Wikimedia Commons

Альтернативное использование ископаемого топлива с энергией нашей самой горячей звезды может быть отличной идеей для снижения тенденции чрезмерного использования ресурсов. Использование солнечных батарей для освещения наших домов в ночное время может сэкономить тысячи мегаватт электроэнергии.

Хотя установка солнечных панелей на крыше может быть дорогостоящей. Но с развитием технологий количество солнечных панелей снижается, и общая стоимость установки этих панелей в долгосрочной перспективе снизится.

Таким образом, для новичков установка солнечных батарей на крошечной площади дома также может привести к значительному снижению потребления электроэнергии.

3. Просвещение людей

Недостаточная осведомленность среди простых людей также является одним из основных аспектов неправильного использования ресурсов, что в конечном итоге приводит к загрязнению.

Правительство каждой страны должно взять на себя ответственность за образование своих граждан. Людей следует обучать с помощью документальных фильмов, короткометражных фильмов, рекламы и кампаний.

4. Общественный транспорт, всегда

Использование общественного транспорта не только обеспечивает простое решение проблемы загрязнения окружающей среды, но также позволяет нам знакомиться с новыми людьми на пути к офису. Это также помогает уменьшить заторы на улицах, позволяя нам быстрее добраться до места назначения.

Недавно правительство Люксембурга отменило все тарифы на проезд в общественном транспорте, чтобы сделать свою страну менее загрязненной и свободной от дорожного движения.Этот небольшой шаг правительства Люксембурга может сэкономить галлоны ископаемого топлива и, следовательно, помочь замедлить процесс изменения климата.

5. Отказаться от ископаемого топлива Источник : Marco Verch / Flickr

Ископаемые виды топлива отвлекли внимание от возобновляемых источников энергии в середине двадцатого века из-за их изобилия и простоты использования. Но мало кто знал, что эти обильные ресурсы скоро закончатся из-за неосторожного использования.

В текущем сценарии стало необходимым сосредоточиться на возобновляемых источниках, таких как ветряные турбины, гидроэлектроэнергия и солнечная энергия.Чтобы сделать эту планету устойчивой для будущих поколений, мы должны научиться отказываться от ископаемого топлива.

6. Ешьте правильно

Почти треть продуктов, производимых нашими фермерами, не попадает в наш желудок. Цифры кажутся весьма тревожными, когда почти каждый девятый человек на Земле страдает от голода.

В местах с низким уровнем доходов и слабой инфраструктурой потеря продовольствия обычно носит непреднамеренный и структурный характер. Но в местах с высоким доходом расточительство происходит по воле людей.

В обеих ситуациях конечный результат схож, и это потеря ресурсов.

Цели устойчивого развития Организации Объединенных Наций призывают к 2030 году сократить вдвое глобальные пищевые отходы на душу населения на уровне розничной торговли и потребления, а также сократить потери продовольствия в цепочках производства и поставок. Чтобы ограничить глобальные потери продовольствия, правительство каждой страны должно сформулировать строгие правила, чтобы избежать потерь.

7. Прекратите рубить леса Источник: IndoMet in the Heart of Borneo / Wikimedia Commons

Вырубка лесов — одна из основных причин, по которым качество воздуха упало до рекордно низкого уровня.Утрата деревьев и другой растительности может вызвать изменение климата, опустынивание, эрозию почвы, сокращение урожая, наводнения, увеличение выбросов парниковых газов в атмосферу и множество проблем для коренных народов.

Из-за уменьшения количества деревьев, окружающая среда Земли подверглась неблагоприятному воздействию. Многие виды флоры и фауны находятся на грани исчезновения из-за потери их естественной среды обитания.

8. Подавление роста населения

Перенаселение перегрузило нашу планету не только с точки зрения пространства, но и с точки зрения продовольствия и воды.Вскоре он станет самой крупной угрозой экологии и биоразнообразию планеты в ближайшие десятилетия.

Глобальное нарушение климата из-за скопления антропогенных парниковых газов в атмосфере скоро станет реальностью, если его не остановить.

9. Отключите свои устройства от сети Источник: trenttsd / Flickr

Практически все устройства, которые мы используем в наши дни, работают от батареек и используют электричество в той или иной форме, и мы, как нерадивые существа, часто оставляем зарядные устройства своих устройства включены и подключены.Это приводит к непрерывному потоку энергии без какого-либо использования.

Итак, чтобы остановить это неправильное использование, каждый человек должен быть осведомлен о потерях из-за этого простого акта небрежности, и его следует научить отключать каждую розетку перед тем, как покинуть свой дом.

10. Переход на электромобили

Источник : Mariordo / Wikimedia Commons

Рынок электромобилей находится на подъеме, и, хотя электромобили пока довольно дороги, они скоро станут эффективной альтернативой для автомобили с бензиновым и дизельным двигателем.Использование электромобилей не только уменьшит загрязнение на Земле, но также уменьшит трафик из-за их крошечных размеров.

Обеспечение крепкого здоровья нашей планеты идет нам на благо. Мы давно эксплуатируем природные ресурсы, но пора осознать ущерб, который они нанесли планете, и предпринять необходимые шаги для защиты нашего единственного убежища.

.

Нужно ли разводить грунтовку | Авто Брянск

От того, насколько будет ровной базовая поверхность, зависит качество оклейки обоями, покраска или наложение декоративной штукатурки.

Но чтобы именно так и получилось, необходимо в точности соблюдать технологию отделочных работ, хотя многие начинающие почему-то забывают о таком этапе как грунтовка.

Как наносить грунтовку на стены?

Грунтовка представляет собой клеящий раствор и предназначена для скрепления поверхности базового покрытия, перед нанесением на него клеевых составов.

Верное подтверждение того, что стена готова под чистовые работы – это отсутствие опадания каких-либо фракций с нее, при проведении каким-нибудь твердым предметом по поверхности штукатурки, в противном случае, проводить чистовые отделочные работы нельзя. Грунтовка выполняется перед:

  • Оштукатуриванием цементно-песчаной смесью;
  • Стартовой шпаклевкой;
  • Оклейкой обоями.

Таким образом, процесс грунтования будет проводиться три раза, причем каждый раз в два слоя, но при этом можно использовать один и тот же инструмент.

Для грунтования на открытых участках применяют валик, а в углах пользуются квадратной кистью, сперва необходимо обработать именно эти места, обильно пройдясь по стыкам ворсом кисти, зато в последующие разы этого можно не делать.

Грунтовочный раствор необходимо налить в пластиковый поддон и периодически смачивать в нем валик, перед раскатыванием по стене, с валика надо удалить излишки жидкости, поскольку она имеет низкую плотность и при избытке станет стекать с ворса. После высыхания первого слоя, аналогично выполняют второй.

Как разводить грунтовку для стен?

Надо сказать, что грунтовка хотя и не самая дорогая составляющая ремонта, однако, при отделке большой площади ее понадобится достаточно много, особенно подготавливая оштукатуренную поверхность под шпаклевку, как известно, цементно-песчаная смесь прекрасно впитывает влагу.

Именно поэтому многие и даже опытные штукатуры практикуют разбавление раствора водой, но в каких случаях это можно делать и каким способом?

Если грунтовка концентрированная, что делается для удобства транспортировки, то разбавлять ее не только можно, но и нужно, делается это в пропорции указанной на упаковке. Для обычной грунтовки все зависит от производителя и обрабатываемой поверхности.

Рекомендуется пропорция – на две части грунта одна часть воды, но необходимое условие – раствор должен быть использован сейчас же и весь, так как к следующему дню его качества значительно ухудшатся.

Разбавлять можно грунт наносимый на бетонную стену под штукатурку или на шпаклевку под обои, а вот на штукатурку под шпаклевку не рекомендуется, так как цементно-песчаная смесь достаточно хорошо впитывает влагу, а от слабого содержания связующих, она может начать отслаиваться.

Чем заменить грунтовку для стен?

Иногда по каким-то причинам, грунтовки не хватает, а если остается обработать небольшой участок поверхности, то посещение магазина нецелесообразно и в таком случае на помощь могут придти различные способы замены грунтующего состава.

Основное предназначение грунтовки, это скрепление поверхности, чтобы она не «сыпалась», значит и замещающее средство должно обладать похожими свойствами. Необходимо иметь ввиду, что ни один заменитель не будет лучше и дешевле грунтовки, поэтому лучше все-таки найти возможность приобрести этот материал.

В качестве заменителя можно использовать разбавленный клей ПВА или водно-дисперсионную краску, а единственным фабричным заменителем можно считать шпатлевку, которая укладывается на штукатурку без грунтовки.

Но стоить такое решение будет естественно дороже, хотя если необходимо сэкономить время, то это самый оптимальный вариант.

Также вам будет интересно видео о том, как правильно грунтовать стены

Многие грунтовки, которые продаются в магазинах, являются готовыми к использованию, их нужно просто размешать, после чего они наносятся на поверхность. Однако есть и концентрированные составы, которые необходимо разбавлять. К тому же, грунтовку для стен необходимо разводить, если она имеет вид сухого порошка. Чем нужно правильно разводить грунт, какой использовать растворитель, и как правильно это делается?
В зависимости от состава грунтовки, нужно использовать разные растворители. К примеру, водно-дисперсионные составы разбавляют обыкновенной водой. Для других смесей необходимо использовать органические растворители. Разбавитель подбирается в зависимости от типа грунта, а также от вида поверхности, на которую будет наноситься смесь. Если планируется работать с очень пористым материалом, то специалисты вообще не советуют разбавлять концентрированный состав.

Преимущества грунтования

Обработанная грунтом поверхность имеет множество достоинств:

  • финишный отделочный материал ложится очень легко и качественно;
  • значительно продлевается эксплуатационный срок отделки;
  • глубоко проникающие составы существенно уменьшают пористость стен, укрепляют их и защищают от осыпания;
  • грунтованная поверхность практически не изнашивается, смесь на протяжении многих лет создает эффективную защиту от коррозии;
  • скрывает, исправляет незначительные дефекты на стенах или на потолке;
  • смесь очень хороша для покраски, лакировки и шпаклевки, благодаря правильно подобранному продукту в значительной мере уменьшается расход финишного материала для отделки;
  • если в грунте есть антисептические добавки, то поверхность становится дезинфицированной, на ней не появляется плесень, грибки, не заводятся различные микроорганизмы и вредители.

Чем разбавлять?

Многие из тех, кто приобретает смесь для обработки поверхности, задаются вопросом: чем и как разводится грунтовка для покраски или для шпаклевки? Всё зависит от приобретаемого типа продукции, сейчас продаются укрепляющие смеси и грунтовки, увеличивающие адгезию. По составу бывают такие материалы:

  • акриловые, их также называют эмульсионные или дисперсионные. Они являются универсальными, ведь используются для любого вида стен, полов и потолков, однако их нельзя применять для обработки металла, они не имеют антикоррозионных составляющих. Чтобы развести грунтовку этого вида, можно воспользоваться обычной водой. Акриловая продукция является не токсичной, чаще всего она не обладает никаким запахом. Чтобы правильно развести данный грунт, моно проконсультироваться у продавца или ознакомиться с инструкцией на упаковке, однако зачастую акриловые укрепляющие смеси и глубокого проникновения разводятся простой водой;
  • алкидные грунтовки используются чаще всего для нанесения на деревянные изделия и любые основания из древесины, для покраски. Благодаря глубокому проникновению эти составы обеспечивают отличную адгезию древесины и лакокрасочных материалов. Они также используются для нанесения на разные металлы, но их не стоит применять для бетонных и кирпичных построек. Как правильно разводить грунтовку этого вида? Обычно используют такой же растворитель, который входит в состав этого грунта, но можно применять другие растворители, например, сольвент или уайт-спирит;
  • полиуретановые и эпоксидные составы применяют, чтобы обрабатывать бетонные стены или потолки, используются они для покраски. Некоторые из видов этих продуктов могут быть использованы для защиты от появления ржавчины на металле, после чего изделия окрашиваются эмалью. Как нужно разводить эту грунтовку для стен и для других поверхностей? В качестве растворителя можно использовать ксилол или какой-либо другой универсальный растворитель, которого должно быть примерно 5-10 процентов, не больше;
  • полистирольные грунты применяют для нанесения на оштукатуренные или деревянные стены, эти грунтовки являются токсичными, поэтому нужно надевать индивидуальные средства защиты, и следить за тем, чтобы вентиляция в помещении была достаточной во время выполнения работы. Желательно использовать для наружных, фасадных стен. Чтобы развести грунтовку этого вида, нужно соблюдать инструкцию, в которой будет указано, какой растворитель необходимо использовать;
  • смеси для обработки металла состоят из разных компонентов, которые могут преобразовывать ржавчину, создавать изоляционный или защитный слой. Эти концентраты нужно правильно развести при помощи рекомендуемого изготовителем растворителя, объем которого должен быть максимум 10 процентов от объема смеси. Данные грунты нельзя разбавлять водой. Чаще всего используют универсальные разбавители;
  • перхлорвиниловые препараты используют, чтобы обрабатывать фасадные кирпичные и бетонные стены. Зачастую они реализуются готовыми к использованию, не нуждаются в разбавлении. Однако при повышенной вязкости можно использовать органические растворители, сольвент или ксилол, который обычно входит в состав этих продуктов.

Разбавляют смеси для грунтования, чтобы они лучше ложились на поверхность и быстрее высыхали. Разводить грунты нужно практически всех видов, кроме глубоко проникающих составов, которые гораздо лучше проявляют себя, и работать с которыми намного легче в оригинальном, не разбавленном состоянии.

Вывод

Специалисты советуют обязательно использовать подходящий вид грунтовочный продукции во время выполнения ремонтных или отделочных работ. При нанесении нескольких слоев грунта поверхность будет прочная, отделка прослужит гораздо дольше. Чтобы разводить грунтовочные составы, можно руководствоваться информацией из этой статьи, кроме этого, можно проконсультироваться у опытного продавца, а также обязательно прочитать инструкцию по применению продукции и использовать именно тот вид разбавителя в необходимой пропорции, которую рекомендует изготовитель.

Скромная снаружи, но такая важная внутри. Речь о грунтовочной смеси и ее мощных функциях. Благодаря ей настенные и потолочные покрытия отлично держатся и прекрасно смотрятся.

Грунтовка — залог красивой поверхности и качественного ремонта

Ремонт требует основательного подхода, физических усилий и финансовых затрат.

Чтобы результат радовал своих хозяев долго, важно ничего не упустить.

Привести стены и потолки в достойный вид без грунтовочной пропитки не выйдет.

Что такое грунтовка

Это строительный состав в виде жидкости, которым обрабатывают стены, полы, потолки.
Выполняет следующие задачи:

  • усиливает адгезию — сцепление разнородных материалов, в данном случае между
  • обрабатываемой поверхностью и отделкой;
  • укрепляет основание;
  • выравнивает слой;
  • защищает от коррозии;
  • экономит расход краски.

Состав смеси зависит от ее прямого назначения и типа поверхности. Накладывается она на:

Когда применяется огрунтовка

Как правильно нанести грунтовку на стены и потолок, как правильно грунтовать

Чтобы итоговое покрытие настенными и потолочными материалами выглядело как нельзя лучше, следует придерживаться нескольких пунктов и рекомендаций.

Нужно ли разводить с водой

Если речь идёт о готовой смеси — ее достаточно хорошенько размешать. Концентрат же требует добавления воды. Отношение грунтовой пропитки к воде: два к одному, но обычно производитель уточняет об этом на упаковке индивидуально для своего продукта.

Какой лучше валик выбрать

В магазине представлен широкий ассортимент валиков. Практический опыт показывает, какими из них работать лучше и удобнее в той или иной ситуации.

Валик состоит из рукоятки с держателем и ролика. Рукоятку принято выбирать прочную, чтобы инструмент прослужил долгие годы. Ролик с «шубкой» из поролона, меха, велюра
со временем изнашивается и требует замены.

Поролоновый применяют для нанесения смеси густой консистенции. Меховой считается универсальным, он подходит как для густой, так и для жидкой смеси. Желательная длина ворса — 15 мм.

Велюровый также справляется с жидкими и густыми составами. Ворс такого типа валика не превышает 5 мм, поэтому им следует грунтовать исключительно гладкие поверхности.

Каким валиком лучше быстрее грунтовать

Для ускоренного темпа работы стоит воспользоваться меховым валиком и удлинителем рукоятки с телескопической конструкцией.

Нужно ли мыть стены

Перед непосредственным нанесением грунтовочного покрытия следует убедиться, что обрабатываемое место очищено от грязи и пыли. Достаточно пройтись по нему простым шпателем, а затем влажной губкой.

Сколько слоев нужно нанести

Количество наносимых слоев зависит от степени неровностей стен и потолков. Мастера рекомендуют грунтовать в два слоя для достижения качественного результата. Причем после каждого слоя обязательно дать покрытию высохнуть.

Нанесение

Для начала требуется правильно определиться с выбором грунтовочной смеси. Он зависит от:
  • гладкости/пористости поверхности;
  • типа финишного отделочного материала.

Совершенно неважно — стены или потолок необходимо пропитать, в этом плане разделения нет.

Процесс работы нельзя назвать сложным. Для удобства и наилучшего результата необходимо воспользоваться специальным лотком — малярной ванночкой, куда следует перелить часть строительной пропитки. Валик, смоченный в составе, раскатывается по ванночке, отжимая излишки. Это обязательное условие, чтобы во время обработки жидкая смесь не стекала с поверхности.

Популярные грунтовки

Грунтовочная смесь подразделяется на 3 типа:
  • краска;
  • средство глубокого проникновения;
  • бетон-контакт.

Краска используется на гладком и ровном основании. Для пористых, шероховатых и хорошо впитываемых влагу мест применяют покрытия глубокого проникновения. Бетон-контакт наносится под декоративную штукатурку.

Для бетона, кирпича, гипсокартона и камня подойдёт акриловая грунтовочная пропитка. Для деревянных и металлических оснований — алкидная. Силикатной обрабатывают кирпич и наружную штукатурку.

Лидерами продаж являются Ceresit CT 17, Tiefgrund LF D 14, Bindo Base, Acton, Opti Grund E.L.F.

Когда можно проводить покраску, поклейку

После нанесения состава, стены и потолок должны полностью просохнуть. В этот промежуток нужно приостановить все ремонтные работы, чтобы поверхность оставалась чистой. Время высыхания зависит от типа основания, влажности и температуры помещения, иногда на это уходит 4 часа, а иногда целые сутки. Если место, на которое нанесено средство, уже не прилипает к рукам — пора отделывать его облицовочными материалами.

Грунтовка необходима для качественного ремонта и долговечности результата. Пренебрежение этой процедурой приведет к дефектам и недостаткам поверхности, которые после окончательной отделки станут заметны невооруженным глазом.
Помимо идеального внешнего вида стены и потолок усилят свои прочностные характеристики, на них не появится плесень.

Полезное видео

«>

процесс нанесения и правильные пропорции при разведении

Одним из важнейших подготовительных этапов поверхности при ремонте является грунтовка стен. Не все знают об этой обязательной процедуре и зачастую просто ее игнорируют. Отсутствие грунтования на стенах может привести к проблемам в виде плесени или отслоившегося материала отделки. Перед проведением процедуры необходимо подробнее изучить виды и особенности применения грунтовки.

Зачем нужна грунтовка стен

Качественное грунтование обеспечивает стенам защиту от множества факторов. Отсутствие грунта на поверхности делает ее шероховатой, что в последствие влияет на адгезию (сцепление) отделки со стеной. Кроме того, после поклейки под полотнами будут видны мелкие выступающие точки, что обязательно отразится на внешнем виде покрытия.

В некоторых случаях можно обойтись и без грунтовки, но если за цель ставится долговечный и качественный ремонт, лучше выполнить данную процедуру. Укрепление плоскостей и их подготовка под дальнейшую отделку — вот для чего нужна грунтовка стен.

Следует ответить на вопрос о том, что такое грунтовка, какие функции она выполняет:

  • придает прочность обрабатываемой поверхности;
  • предназначена для сцепляемости плоскости с отделкой, поскольку проникает глубоко в поры;
  • способна впитать клеевые составы, шпатлевку и краску, поскольку обладает связующими свойствами..

Данная процедура является завершающим этапом перед отделкой стены. Чаще всего нанесение грунтовки на стены проводится в две фазы, чтобы окончательно укрепить покрытие.

Обладая множеством полезных свойств, грунтовка хорошо устраняет возможный грибок и плесень, а также удаляет оставшиеся частички штукатурки. Обои прослужат дольше и не отклеятся от стен в процессе эксплуатации.

Разновидности смесей

Сегодня в ассортименте имеется множество видов грунтовочных составов, каждый из которых подходит под определенный случай. Грунтовка для плоскостей классифицируется согласно материалу, на котором будет применена. Выделяют такие виды:

  • для металлических оснований;
  • для сыпучих материалов;
  • для деревянных стен.

В грунтовочный состав обычно входят смолы и другие компоненты. Отдельного внимания заслуживает акриловая грунтовка, которая применяется для стен, покрытых шпаклевкой. Состав проникает глубоко в основание, благодаря чему приклеенные обои прочно и надежно крепятся на стену. Иногда заменой такому компоненту является обычный обойный клей, который обладает подобными свойствами.

Для поверхностей из дерева применяются алкидные грунтовочные смеси. Но почему нельзя применять универсальные смеси для дерева? Некоторые изделия совершенно не подходят для обработки древесины. Алкидный состав не только отлично проникает в основание, но и уберегает его от появления паразитов. Кроме того, он создает невидимую прочную пленку на плоскости, которая прекрасно поддается оштукатуриванию. Перед тем как грунтовать стены, убедитесь, что деревянная плоскость лишена выступающих элементов.

Если за цель поставлено самостоятельное приготовление обработки из клея для обоев, при его размешивании добавьте в емкость кусочек стекловолокна. Материал сможет собрать на себя все сгустки и комки состава для грунтовки стен.

Правильные пропорции при разведении

Многие смеси продаются уже готовыми к использованию. Достаточно просто взболтнуть их и определиться, чем наносить грунтовку на стены. Некоторые производители предлагают грунт в виде концентрата, который обязательно нужно развести жидкостью. Необходимо разобраться, как наносить грунтовку на стены так, чтобы это не нанесло вреда будущему покрытию.

Все составы делятся на укрепляющие и повышающие сцепление варианты. В зависимости от основного компонента, изготовители рекомендуют разводить грунтовку поверхности стен следующими жидкостями:

  1. Алкидный концентрированный грунт, применяемый для деревянных плоскостей, лучше развести подобным органическим растворителем по типу уайт-спирита или сольвента в пропорциях 1:1. Необходимо применять разведенное вещество только на поверхностях, указанных на этикетке.
  2. Для растворения эпоксидной грунтовки, предназначенной для обработки бетонных стен, можно использовать ксилол или похожее универсальное вещество в пропорциях 1:1.
  3. Водоэмульсионная или акриловая грунтовка обычно продается разведенной, однако бывает и в виде концентрата. Разбавить его можно с помощью обычной чистой воды в размере 20% воды от объема грунтовки.
  4. Грунтовки по металлу разбавляются растворителями в объеме 10%. Ни в коем случае не рекомендуется добавлять в такие составы воду – срок действия вещества сокращается. Грунтование стен с металлическим основанием предполагает наличие смеси с антикоррозийными свойствами.

 

Соблюдение пропорций является залогом хорошего результата. Если изготовитель не оставил заметку на этикетке про соразмерность веществ, разводите грунтовку на штукатурку и другие плоскости в объеме не более 5-10% от общего количества состава.

Способы нанесения

Процесс нанесения грунтовочной смеси достаточно прост, однако требует внимания к некоторым деталям. Следует подробнее разобраться в алгоритме действий перед тем как грунтовать стены:

  1. До нанесения смеси очистите всю поверхность от загрязнений.

Для этого можно использовать строительный пылесос, если объемы работ большие. Для небольших площадей применяется широкая кисть, которая с легкостью очищает стену перед нанесением грунта.

  1. Вылейте состав в специальный кювет, в котором тщательно его размешайте.

Для работы используется специальный инструмент – валик. Он смачивается в веществе и раскатывается для удаления излишков. Только тогда можно приступать к процедуре. Если грунт требует разбавления, не забудьте его осуществить именно на данном этапе. Большинство владельцев, самостоятельно осуществляющих ремонт, полагают, что слой грунта должен быть толстым. Это ошибочное утверждение приводит к дефектам.

Перед тем как грунтовка наносится на стену, с поверхности валика удаляется все лишнее, чтобы добиться тонкого слоя.

  1. Когда основное пространство обработано, стоит перейти к угловым участкам. Валик в данной ситуации будет непригоден, здесь смесь наносится с помощью кисточки.
  2. После завершения процедуры стены должны полностью высохнуть.

При необходимости, работу можно повторить, но только после того как впитается первый слой. Грунтовка для стен обычно высыхает за 24 часа – данная информация указывается изготовителем на упаковке.

  1. После того, как стены стали сухими, проводится последующая отделка необходимыми материалами.

Теперь, когда вы знаете, как правильно грунтовать стены, можно приступать к самостоятельному осуществлению процесса.

Тонкости грунтования перед штукатуркой

Важно знать, как правильно подготовить плоскость под штукатурку или шпаклевку. Грунтовка оказывает антисептическое, обезжиривающее и противогрибковое воздействие на бетон, поэтому применять ее нужно в обязательном порядке. Главная особенность применения смеси состоит в том, чтобы каждый последующий слой штукатурки был обработан и полностью высушен. Для штукатурки и шпаклевки применяется акриловая грунтовка – она наиболее уместна в данном типе работ.

На видео: тонкости грунтования.

Работа по грунтованию производится для того, чтобы не произошло отслаивания штукатурки в процессе эксплуатации – смесь надежно закрепит ее на плоскости. Сама процедура грунтовки стен осуществляется тем же методом, что и при обработке поверхности перед поклейкой обоев.

Прежде чем начать грунтовать, стены должны подсохнуть. Тонкий и аккуратный слой состава проще закрепится под материалом штукатурки. То же самое касается и шпаклевки: благодаря мелкой зернистости она лучше ляжет на грунтованную плоскость.

Современные отделочные смеси имеют высокую стоимость. Но зачем грунтовать стены в таком случае, разве нельзя сэкономить? И вновь вспомните о том, что неподготовленное основание может неплохо испортить покрытие. Не пренебрегайте использованием грунта перед отделкой декоративной штукатуркой.

Особенности выбора

Первоначально для выбора состава важно определиться, насколько сильно основание стены впитывает жидкость. Этот фактор обуславливает пористость плоскости. В зависимости от степени проникновения грунтовки на штукатурку, бетон или дерево, выберите соответствующий тип грунтовки:

  1. Для менее пористых покрытий выбирайте грунт с хорошей адгезией.
  2. Стены со средней пористостью отлично впитывают любой состав, такие вещества сохнут очень быстро.
  3. Для плоскостей с крупными порами нужна грунтовка глубокого проникновения

 

Стену, изготовленную из бетона, грунтуют специальным минеральным составом. Такой метод позволяет максимально увеличить адгезию поверхности к будущей отделке. Если работы проводятся в помещениях с высокой влажностью, тогда нужно использовать грунт со специальным составом, предотвращающий появление грибка.

Перед тем как начать наносить строительную грунтовку на вашу стену, на ней не должно быть посторонних частиц. Позаботьтесь об этом заранее. Достигнуть качественного результата можно только при соблюдении всех указанных правил и методик. Не стоит покупать первую увиденную в магазине смесь. Чем лучше состав будет подходить под определенные нужды, тем лучше получится ремонт.

 

Как правильно грунтовать стены (2 видео)


 

Бренды и проведение работ (23 фото)

Как развести грунтовку различных видов, пропорции разведения

Большинство грунтовых растворов можно приобрести в специальных строительных магазинах. Зачастую продукция грунтовки представлена в виде сухого грунта, который требуется размешать. Самые концентрированные можно хорошенько развести и наносить на поверхность стен. Правильно как развести грунтовку, узнаем из нашей статьи.

Что использовать в качестве разбавителя для различных видов грунтовок

Грунт различается по своим различным свойствам и применению. При этом выделяются:

  1. Укрепляющего типа.
  2. Повышающего типа (адгезию).

Узнаем, чем правильно разбавить грунтовку.

1.Акриловую называют также дисперсионной или эмульсионной. Этот вид считается универсальным, так как находит применение для всех видов стеновых поверхностей, потолков. Акриловый раствор разбавляется водой. Акриловый может быть и грунт.

Важно!

Нельзя использовать по металлу, так как у нее отсутствуют антикоррозийные свойства.

2.Алкиднаую применяют часто для обработки деревянных стен, полов для дальнейшей покраски. Она проникает глубоко и разрыхляет верхний слой дерева, поэтому раствор обеспечивает наилучшую адгезию основания и краски. Её применяют под эмаль и для работ по металлу. Но не нельзя применять для стен из бетона или камня. Концентрат снижается схожим растворителем, что и содержится в составе грунта, или целесообразно использовать Уайт — спирит, ксилол и другие.

3.Эпоксидную или полиуретановую рекомендуется использовать для нанесения обработки стен, а также потолков под эмаль. Отдельные смеси предопределяются для проведения действий по металлу с последующим нанесением эмульсионной жидкостью. Для нанесения подходит ксилол или иная универсальная смесь. Полистирольного типа применяют для нанесения стеновых покрытий – по штукатурке и дереву. Содержащийся состав считается вредным, так как преобладают токсичные свойства вещества, вследствие этого рекомендуется соблюдать индивидуальную защиту, также хорошо проветривать квартиру во время обработки.

4.Грунтовка для металла относится к отдельной категории.

В составе смеси входят разнообразные вещества, в содержание свойства входят следующие компоненты:

  •  изоляция;
  •  протекция;
  •  преобразование.

Чтобы правильно разбавлять, надо знать, чем разбавить грунтовку. Чтобы её развести, её разбавляют разнообразными растворителями до 10% от всеобщего объёма, но не водой. Раствор для покрытий, состоящих из металла, непременно проводить в несколько слоев под эмаль, а также покраску стеновых поверхностей. Они создают прочную водонепроницаемую пленку.

Перхлорвиниловая предназначается для возделывания наружных стен. Обычно такие растворы имеют нормальную консистенцию. В составе содержится растворитель, им же и разбавляется, если очень вязкий состав. Если развести грунтовку, то она лучше наносится и стремительнее берется. Опытные строители советуют выполнять промежуточные строительно-ремонтные работы непосредственно грунтовкой.

Правильные пропорции при разведении грунтовки

Чтобы развести грунтовку, надо знать точные пропорции для её разведения.

Смесь не самая дорогостоящая для ремонта, но при наличии огромной площади помещения её понадобится довольно много, в особенности, если она пойдет под штукатурку поверхности. Может быть поэтому высококвалифицированные строители разбавляют её водой, но в каких случаях и какие пропорции нужны для её разведения?

Когда она хорошая, концентрированная по своим свойствам, то её обязательно нужно развести, а как это делается можно посмотреть на упаковке, где указана полная информация о применении. Для обыкновенного раствора специалистами рекомендуется следующая пропорция: развести на две части компонента одной части воды.

Важно!

Разбавленную смесь необходимо использовать в полном объеме за раз, так как ее свойства при длительном хранении в разведенном виде значительно ухудшаются.

Разбавленная наносится на бетонную стену под штукатурку или на шпаклевку под клейку обоев, а наносить на штукатурку не рекомендуется, так как смесь, состоящая из цемента и песка, отлично может впитывать влагу, а от небольшого состава, может произойти отслоение.

Когда в доме отсутствует грунтовка, чуть–чуть не хватает для обработки небольшой поверхности участка, посещать магазин не рекомендуется, так как заменить грунт можно другим способом. Главная функция грунтовки – скрепить поверхности, чтобы она не осыпалась, значит и замена её варианта должна быть схожей, обладая аналогичными сходствами. Для замены смеси подойдет разбавленный клей ПВА или подойдет краска водно-дисперсионная. А единственный выход, чтобы заменить грунт является шпатлёвка, которая может укладываться без грунтовки.

Важно!

Имейте ввиду, что грунтовка — самое наилучшее средство для обработки стен, потолков, полов. Заменить её можно только в том случае, когда её не хватает для обработки незначительного участка, а покупать в магазине нецелесообразно из-за маленького объёма работы.

От того, какая будет ровная базовая поверхность, зависит не только от качественной наклейки обоев, но и от наложения декоративной штукатурки. Но чтобы стены были ровными, важно именно на них наносить для этого специально предназначенную грунтовку. По желанию хорошо концентрированный раствор разбавляется.

Нанесением этим составом проводится перед штукатуркой и стартовой шпаклевкой, а также оклейкой обоев. Процесс нанесения грунта осуществляется в три этапа, и каждый раз нужно проводить в несколько слоев специальным валиком. Затем с рабочего валика удаляется лишняя жидкость, а после высыхания первого слоя – выполняется следующий слой.

Как развести грунтовку своими руками?

Большинство грунтовочных смесей продаются уже готовыми к применению. Достаточно хорошенько размешать и можно наносить. Грунтовку концентрат, возможно, потребуется разбавить. Ряд продукции представлен в виде сухого грунта, который перед работой потребуется развести. Как и чем это сделать?

Чтобы ответить на этот вопрос, надо знать состав веществ смеси, а также какой именно растворитель (разбавитель) следует использовать. Например, водно-дисперсионная смесь обычно разбавляется водой. В остальных случаях используется определенный органический растворитель. Выбор разбавителя также может зависеть от типа основания. Кстати, для работы по сильно пористым поверхностям концентрат практически никогда не разбавляют.

Важно знать: какую грунтовку чем разводитьк содержанию ↑

Зачем нужно грунтовать поверхность

  1. На прогрунтованную поверхность последующие отделочные материалы ложатся более качественно.
  2. Грунт продлевает срок службы покрытия.
  3. Глубокопроникающая грунтовочная масса может отрегулировать пористость основы, укрепить ее.
  4. После проникновения грунтовка препятствует износу материала, защищает от коррозии.
  5. Маскировка мелких дефектов.
  6. Грунтовочные смеси под покраску, шпаклевку, лакировку значительно сокращают расход отделочных материалов.
к содержанию ↑

Что использовать в качестве разбавителя

Грунтовки различаются по составу, свойствам, применению. При этом все они поделены на два типа – укрепляющие и повышающие сцепление (адгезию).

  1. Акриловая называется также дисперсионной или эмульсионной. Можно сказать, что она универсальная, так как применяется практически для всех типов поверхностей стен, полов, потолка, но не используется по металлу, так как не обладает антикоррозийными свойствами. Акриловый концентрат можно разбавить водой. Вещество нетоксично, не имеет запаха. Акриловой может быть и сцепляющая грунтовка, и глубокого проникновения.
  2. Алкидная применяется больше для подготовки деревянных стен, полов и других оснований к дальнейшей покраске. За счет глубокого проникновения и разрыхления верхнего слоя дерева, грунтовочная смесь обеспечит лучшую адгезию основания и краски. Применяется под эмаль и для работ по металлу. Но не рекомендовано использовать для стен из камня, бетона и других минералов. Сюда также входят антикоррозийные алкидные смеси с модификатором ржавчины. Концентрат можно снизить аналогичным органическим растворителем, что и в составе смеси, или использовать уайт-спирит, ксилол, сольвент, их смеси.

    Алкидная грунтовка больше подходит для металла, чем для камня, бетона и т.п.

  3. Эпоксидная и полиуретановая используются для обработки бетонного основания стен, полов, потолка, под эмаль. Также отдельные смеси предназначены для работы по металлу (против ржавчины) с последующим покрытием эмалью. Для упрощения нанесения и удлинения времени начала полимеризации, как растворитель, подходит ксилол (5-10% от объема) или другая универсальная жидкость.
  4. Полистирольная используется для стен – по штукатурке и дереву. Вещество токсично. Требует соблюдения мер индивидуальной защиты, а также хорошей продуваемости помещений во время работы и в период высыхания. Безопаснее всего использовать в промежуточной отделке наружных стен постройки.
  5. Грунтовки для работ по металлу вообще выделены в отдельную группу. В составе могут содержаться различные вещества, отвечающие за особенные свойства материала: изоляция, протекция, преобразование. Концентрат разбавляется различными растворителями до 10% от общего объема, но только не водой. В основном используются типы «родных» органических растворителей или универсальный. Грунтование металлических конструкций в несколько слоев обязательно под эмаль, покраску и в условиях постоянной влажности.
    • изолирующие, уберегающие от проникновения влаги и образования ржавчины, – глифталевые, фенолформальдегидные составы. Образуют прочную, водонепроницаемую пленку;
    • протекторные (пассивирующие) – делают железо невосприимчивым к влиянию агрессивных сред, то есть увеличивают его изоляцию;
    • преобразующие – переводят ржавчину в труднорастворимое или быстро разрушаемое соединение, увеличивают адгезивные свойства материалов.
  1. Перхлорвиниловая предназначена для обработки наружных стен из бетона и кирпича. Обычно такие составы имеют нормальную рабочую консистенцию. В составе присутствует органический растворитель (ксилол или сольвент), им же и разбавляется, если уж слишком вязкая.

Разбавленная, грунтовочная смесь лучше ложится, быстрее схватывается. Тем не менее, глубокопроникающая лучше себя проявляет как раз в неразбавленном виде.

Специалисты рекомендуют при выполнении промежуточных строительно-ремонтных работ непременно производить грунтование. В свою очередь производители строительных смесей побеспокоились о том, чтобы клиент смог беспроблемно использовать материал, снабдив упаковку инструкцией по применению.

Как развести новые праймеры для ПЦР

В этой статье я объясню, как легко приготовить исходные праймеры для ПЦР и как развести их в рабочем растворе праймеров.

Освоение кПЦР

Видеоурок о том, как разводить новые праймеры qPCR, можно найти в нашем курсе Mastering qPCR
>> Используйте код 20QPCR , чтобы получить 20% скидку <<

Перед тем, как начать

Итак, вы разработали и заказали грунтовки, и теперь они наконец-то прибыли.Но как подготовить лиофилизированные (лиофилизированные порошковые формы) олигопраймеры для использования в ПЦР? Если у вас нет возможности приготовить грунтовки сразу, храните их по адресу 4 o C , пока не придет время.

Перед тем, как начать, вот несколько общих советов по работе с праймерами для ПЦР:

  • Убедитесь, что вы работаете в среде, свободной от ДНК. Желательно в вытяжном шкафу для подготовки к ПЦР. Это сделано для того, чтобы избежать загрязнения вашего инвентаря и рабочих растворов грунтовки.
  • Используйте воду для ПЦР (без ДНКазы и РНКазы) для восстановления и разбавления праймеров.
  • Используйте наконечники для пипеток с фильтром, чтобы предотвратить загрязнение при дозировании.

Чтобы подготовить праймеры для ПЦР, выполните два простых шага:

1. Восстановите ваши стандартные грунтовки

Перво-наперво, вам следует ненадолго (примерно 30 секунд) центрифугировать праймеры, чтобы стянуть весь лиофилизированный порошок на дно пробирки. В противном случае, если порошок застрянет в крышке при открытии тюбика, вы потенциально можете повредить свои праймеры.

Затем вам необходимо восстановить ваши праймеры водой, пригодной для ПЦР, чтобы получить исходный раствор 100 мкМ .Но сколько воды нужно добавить? Количество добавляемой воды для ПЦР зависит от количества наномолей (нмолей) этого олигопраймера. Обычно его можно найти на самой трубке или на листе грунтовки, поставляемом с заказом.

На каждые 1 нмоль добавьте 10 мкл воды, пригодной для ПЦР.

Например, если праймер утверждает, что 19,4 нмоль , добавьте 194 мкл воды, пригодной для ПЦР.

Смешайте раствор встряхиванием, чтобы восстановить праймеры.Храните запасы грунтовки при -20 o C .

2. Приготовьте рабочий раствор грунтовки

Никогда не используйте исходные праймеры непосредственно в ПЦР, потому что они очень концентрированные. Работать от одной трубки — тоже плохая идея. Достаточно лишь небольшого количества загрязнений, чтобы проникнуть в пробирку, и вам придется заново заказывать праймеры.

Следовательно, лучше всего создавать рабочие растворы с более низкой концентрацией. Выбор концентрации рабочего раствора грунтовки полностью определяется пользователем.Наиболее распространенная концентрация рабочего раствора праймера — 10 мкМ .

Чтобы приготовить рабочий раствор праймера 10 мкМ , выполните следующие действия:

  • Добавьте 10 мкл исходного раствора праймера в пробирку, свободную от РНКаз и ДНКаз.
  • Добавьте 90 мкл воды, пригодной для ПЦР.
  • Перемешать встряхиванием.

Составьте аликвоты и храните рабочие растворы праймеров при -20 o C . Избегайте чрезмерного оттаивания рабочих грунтовок.

Кредит предоставленного изображения: Манчестерская цифровая лаборатория MadLab (через Flickr)

ПЦР для разведения праймеров и олигонуклеотидов

1. В настоящее время праймеры заказываются у SIGMA GENOSYS или у других в зависимости от цены (не забудьте учесть стоимость доставки и разницу в стоимости с дублированием).

2. Используйте систему заказа на веб-сайте, которая содержит правильную информацию о доступных весах — если вы заказываете больше, чем c.6 грунтовок, объемная подача проще.

3. Заказ в маленьком масштабе: 0,05 мкм или (меньше) 3 OD (но обратите внимание от Sigma-Genosys, что минимальный масштаб соответствует цене следующего размера, поэтому заказывайте больший; иногда минимальный масштаб недоступен для олигосодержащих дублирования или модификации).

4. Когда придут олиго, поместите исходный лист данных и изображение геля в Книгу Мастера Олиго. Сделайте для себя ксерокопию.

5.В вытяжном шкафу с ламинарным потоком восстановите высушенные олигонуклеотиды в воде (например, SIGMA) для молекулярной биологии, чтобы получить 100 М (микромолярный) исходный раствор; В дополнение к исходной пробирке с исходной жидкостью сделайте две аликвоты по 20 л (микролитры). (Oligos будет более стабильным в слегка забуференных солях, например TE, но это может ингибировать ферментативные реакции.) В таблице данных будет указано количество мкл воды, необходимое для этого разведения — обычно от 300 до 800 мкл. (Они также дают наномоли при синтезе — т.е.грамм. 46,6 нмоль. Чтобы приготовить 100 мкМ маточного раствора, умножьте это на 10 и добавьте большее количество мкл воды (например, 233 мкл для 46,6 нмоль = 200 мкМ исходного раствора).

6. Напишите название олиго на крышке пробирки. Затем поместите исходный запас в обычную олиго-коробку (обычно большие люминесцентные коробки в высоких морозильных камерах в ящиках Трюд или Пэт).

7. Небольшие аликвоты определенных исходных олигонуклеотидов можно хранить в отдельных коробках в морозильной камере..

8. Приготовьте небольшое количество рабочего раствора, разбавив аликвоты 100 мкМ исходного раствора (в вытяжном шкафу с ламинарным потоком) водой для молекулярной биологии.

— 1:10 дает 10 М раствор для геномной ПЦР. Если вы используете 1 мкл этого исходного раствора в 20 мкл смеси для ПЦР, вы используете 0,4 мкМ праймера в конечной смеси.

— 1:20 с получением 5M для плазмидной ПЦР

9. Проведение ПЦР с использованием полимеразы YorkBio или Promega Taq (раньше мы использовали Bioline, теперь дороже):

· вода (сначала добавьте)

· 1.5 1 из 50 мМ MgCl (конечная концентрация 1,5 мМ)

· 5 л Буфера для ПЦР (поставляется с Taq)

· 1 л 10 мМ dNTPmix или 41 2,5 мМ dNTPmix (конечная концентрация 200 M; см. Ниже)

· 2,5 л каждой грунтовки ‘

· 5-10 нг ДНК

· 0,1-0,5 л полимеразы Taq (= от 1 единицы до 5 единиц)

· ИТОГО 50л

Банкноты

· Уменьшение объема ПЦР до 20-30 л для типирования маркеров и тестирования (возможно даже до 7 л).Используйте только 50 мкл, если вам нужно вырезать и клонировать

.

· Смесь dNTP: мы использовали для приготовления 2,5 мМ рабочего раствора в Tris-HCI, но ROCHE рекомендует приготовить раствор 10 мМ, добавив 51 компонент dATP, dCTP, TTP и dGTC (каждый 100 мМ; поставляемый ROCHE) на 30 л стерильных двойных дистиллированная вода.

ВНИМАНИЕ, ЧТО РАЗБАВЛЕННЫЙ OLIGOS МОЖЕТ ПРОБИТЬСЯ ПРИ РАЗМОРАЖИВАНИИ НЕСКОЛЬКИХ РАЗ.

ПРИ ОБРАЩЕНИИ С OLIGOS ВСЕГДА НАДЕВАЙТЕ ПЕРЧАТКИ.

ЗАПАС праймера M13 И РАЗБАВЛЕННЫЕ АЛИКВЫ БУДУТ СОХРАНЯТЬСЯ В ОБЩЕЙ БЛОКЕ ПЦР.

Трюде Шварцахер

Январь 2004 г. / PHH сентябрь 2008 г.

Как рассчитать концентрацию праймера ДНК

Расчеты могут быть отравой лабораторной работы. К счастью, есть много простых методов, которые помогут вам выполнить необходимые математические вычисления в лабораторных условиях. Здесь мы расскажем вам о различных способах расчета концентрации праймера в зависимости от исходного материала.

Для всех расчетов предположим, что у нас есть 22 нмоль праймера ДНК, содержащего 16 оснований.

из лиофилизированного порошка

Праймеры

, которые вы покупаете у компаний, часто доставляются в виде лиофилизированных порошков, и компания сообщит вам, сколько нмолей праймера они предоставили. Если вы уверены, что восстановили весь порошок и ранее не испытывали проблем с количеством присланного грунтовки, то быстрое повторное суспендирование и расчет можно выполнить без измерения OD грунтовки.Однако, если последующее нанесение праймера очень чувствительно к концентрации праймера или если вы не уверены в качестве праймера, вам следует измерить OD праймера после ресуспендирования и использовать второй метод ниже для расчета.

Метод 1) Ресуспендируйте праймер в 100 мкл воды или буфера и используйте следующий расчет:

(XX нмоль / 100 мкл) x (1000 пмоль / нмоль) = пмоль / мкл = мкМ

Пример: (22 нмоль / 100 мкл) x (1000 пмоль / нмоль) = 220 пмоль / мкл = 220 мкМ

Метод 2) В качестве альтернативы можно быстро ресуспендировать праймер до концентрации 100 мкМ путем ресуспендирования порошка в объеме в микролитрах, который в 10 раз превышает количество нмоль.

Пример: Ресуспендируйте 22 нмоль праймера в 220 мкл = 100 мкМ

Из жидкости

Иногда мы не так осторожны и организованы, как следовало бы, и обнаруживаем в морозильной камере тюбики с праймерами без надписей о концентрациях. Иногда вы даже можете обнаружить, что не получили полного количества лиофилизированного праймера, присланного компанией. В этих случаях вы можете легко рассчитать концентрацию праймера по показаниям OD 260 . Предположим, что мы разбавили праймер сверху 1: 200 и показание OD260 было 0.132.

Концентрацию можно рассчитать по следующим формулам:

(OD 260 ) x (0,02 *) x (коэффициент разведения) = мкг / мкл * Коэффициент преобразования для одноцепочечной ДНК

(мкг / мкл / 330 дальтон / нуклеотид **) x (10 6 / количество нуклеотидов) = мкМ ** Средняя молекулярная масса на нуклеотид

Пример: (0,132) (0,02) (200) = 0,528 мкг / мкл

(0,528 / 330) x (10 6 /16) = 100 мкМ

Есть вопросы? Сообщите нам об этом в комментариях!

Первоначально опубликовано в 2013 г.Обновлено и переиздано в 2017 году.

Вам это помогло? Тогда поделитесь, пожалуйста, со своей сетью.

концентраций и ресуспендирование грунтовки | Университет Северной Британской Колумбии

В информации о праймере

, полученной от компании, будет указана молекулярная масса вашего праймера (г / моль) и количество нанометров, которые они отправили. Если у вас 29,4 нмоль праймера и вы хотите приготовить 100 мкМ маточный раствор в TE — просто умножьте количество нмолей на коэффициент десять и добавьте это количество микролитров.В этом примере добавьте 294 мкл.

Расчеты
100 мкМ = 100 мкмоль / л = 0,1 нмоль / мкл
29,4 нмоль X 1 мкл / 0,1 нмоль = 294,0 мкл

Наша общая практика состоит в том, чтобы приготовить 100 мкМ маточный раствор с ТЕ, а затем разбавить до рабочего раствора 10-20 мкМ, используя Трис pH 8,3 или отфильтрованный ddH 2 O.
Подтвердите концентрацию с помощью нанокапли, потому что концентрации указаны компании часто ошибаются. Для нанесения наноразмеров праймера необходимо изменить параметры настройки для измерения однонитевого шаблона.Вы также увидите ДНК-33, которая относится к зависящему от длины волны коэффициенту экстинкции в нг-см / микролитр:
• Двухцепочечная ДНК: 50
• Одноцепочечная ДНК: 33
• РНК: 40

Нанокапля дает показания в нг / мкл, но вам часто необходимо преобразовать это значение в пмоль / мкл. Если ваш праймер имеет молекулярную массу 6000 г / моль, это то же самое, что сказать 6000 нг / нмоль, а показание нанокапли составляет 9,6 нг / мкл, вот как преобразовать значение topmol / мкл:
9,6 нг / мкл ÷ 6000 нг / нмоль = 0.0016 нмоль / мкл
0,0016 нмоль / мкл X 1X10 3 пмоль / нмоль = 1,6 пмоль / мкл

Концентрации нуклеотидов

Нуклеотиды для реакций ПЦР сокращенно обозначаются dNTP, где N относится к четырем нуклеотидам (ATCG). Обычно они поставляются с каждым дНТФ с концентрацией 100 мМ. Их суспендируют и разбавляют в фильтрованном ddH 2 O. В стандартной реакции ПЦР используется 2 мМ каждого dNTP.

Расчеты
Для создания рабочих запасов 100 мкл:
M 1 V 1 = M 2 V 2
100 мМ X V 1 = 2 мМ X 100 мкл
V 1 = 2 мкл
Следовательно, добавьте 2 мкл каждого dNTP (2 мкл X 4 dNTP = 8 мкл) в 92 мкл отфильтрованного ddH 2 O.

протоколов ОТ-ПЦР | Управление по научным вопросам

Синтез кДНК
Установка реакции ПЦР в реальном времени
Запуск ПЦР в реальном времени
Одношаговая ОТ-ПЦР
Подготовка ДНК для стандартной кривой
Последовательности праймеров для генов внутреннего контроля
Секвенирование продуктов ОТ-ПЦР

Синтез кДНК

  1. Получить 5 мкг общей РНК в 7 мкл h3O 1
  2. Добавить 5 мкл праймера (100 нг / мкл) 2
  3. Денатурация при ~ 85 ° в течение 3 минут.Положить на лед, затем быстро покрутить
  4. Добавить 4 мкл 5-кратного буфера для первой цепи, 2 мкл 0,1 М DTT и 1 мкл 15 мМ dNTP 3
  5. Тщательно перемешайте и инкубируйте при 42 ° в течение 2 минут для доведения образцов до нужной температуры
  6. Добавить 1 мкл обратной транскриптазы Superscript II 4 (200 Ед / мкл). Инкубируйте при 42 ° в течение ~ 1 часа.
  7. Деактивировать при ~ 85 ° на 10 минут
  8. Разбавьте кДНК в зависимости от количества доступной РНК. Мы успешно использовали разведения до 1:17

Примечания
Этот протокол, по сути, является методом, предоставленным Invitrogen для использования с обратной транскриптазой Superscript II.К реакционной смеси можно добавить 1 мкл RNasin (20 000-40 000 Ед / мл) для обеспечения целостности мРНК.
После того, как кДНК изготовлены, они должны пройти валидацию. Мы рекомендуем сначала протестировать каждую кДНК с использованием праймеров для гена циклофилина А. Для каждой кДНК, которая должна использоваться для сравнения, уровень экспрессии гена циклофилина А должен быть по существу постоянным.

1 Используйте качество ПЦР h3O
2 Как правило, используйте случайные гексамеры (Rn6) (Invitrogen # 48090-011)
3 Amersham Pharmacia Biotech # 27-2035-01
4 Фермент Invitrogen Superscript # 18064- 022, который поставляется с 5-кратным буфером и 0.1 М DTT

Настройка реакции ПЦР в реальном времени

  1. Дизайн праймеров для получения ампликонов в диапазоне от 150 до 300 пар оснований 1
  2. Установите следующую реакционную смесь при комнатной температуре в следующем порядке
    1 мкл primer.up (6,25 мкМ)
    1 мкл primer.dn (6,25 мкМ)
    10 мкл Qiagen Quantitect Sybr Green-Enzyme and Dye смеси
    8 мкл 1 : 16 кДНК
    20 мкл конечный объем на лунку

Подготовьте мастер-микс для каждого набора кДНК.Обычно каждая точка отбора проб выполняется в трех экземплярах, поэтому обычно проще всего создавать мастер-миксы, которые затем аликвотируются в 96-луночный планшет. Всегда готовьте достаточное количество мастер-микса для одной дополнительной реакции из-за ошибок при дозировании. Например, для трехкратной смеси вы приготовите мастер-микс для 4 реакций:
4 мкл primer.up (6,25 мкМ)
4 мкл primer.dn (6,25 мкМ)
40 мкл Qiagen Quantitect Sybr Green, смесь ферментов и красителей
32 мкл 1:16 кДНК

Примечания
Мы используем только набор Quantitect SYBR Green PCR Kit (Qiagen # 204143).96-луночные планшеты (планшеты MJ Research: # MLL-9651 White; крышки: # TCS-0803 Clear) работают значительно лучше, чем стрипы, очевидно, обеспечивая более равномерную передачу тепла каждому образцу.

1 Воспользуйтесь программой Primer 3 (http://primer3.ut.ee/). В наших руках ~ 90% успеха с праймерами, разработанными с помощью этой программы

Параметры запуска ПЦР в реальном времени

Для MJ Research Opticon следует использовать что-то похожее на следующую программу:

95 ° C 15 мин.
94 ° C 30 сек.
55 ° C 30 сек.
72 ° C 1 мин.
?? ° C ** 10 сек. (** Это температура чтения планшета.)
Plate Read
Перейти к строке 2 еще 39 раз
Выполнить кривую плавления от 65 до 95; читать каждые 0,2 ° C; удерживайте 5 с между чтениями;
Постоянно инкубировать при 12 ° C
Конец

Температура чтения планшета определяется эмпирически. Для типичного эксперимента необходимо сначала определить, работают ли праймеры и фактическую температуру плавления ампликона. В этом пробном эксперименте температура считывания планшета установлена ​​на низком уровне, обычно 68 ° C. В реальном эксперименте температура считывания планшета устанавливается чуть ниже температуры плавления ампликона.

Протокол одноэтапной ОТ-ПЦР

Этот протокол был разработан для использования набора Qiagen QuantiTect SyBr Green RT-PCR Kit в машине DNA Engine Opticon. Объемы реагентов приведены для реакции 20 мкл. При желании эти объемы могут быть увеличены для 50 мкл реакции.

  1. Убедитесь, что в циклер загружен соответствующий мастер-файл, чтобы машина была готова к работе сразу после загрузки планшета.
  2. Разморозьте все реагенты и храните на льду, за исключением смеси Quantitect RT Mix, которую необходимо брать при температуре -20 ° C непосредственно перед использованием, всегда держать на льду и доводить до -20 ° C сразу после использования.
  3. Приготовьте мастермикс для желаемого количества образцов + 1 следующим образом:
    Объемы / образец:
    1 мкл primer.up (25 пмоль / мкл)
    1 мкл primer.dn (25 пмоль / мкл)
    10 мкл 2x QuantiTect SyBr Green Mix
  4. Внесите по 18,5 мкл мастермикса в каждую пробирку / лунку.
  5. Добавьте следующее в каждую пробирку / лунку
    0,2 мкл QuantiTect Reverse Transcriptase Mix (добавьте первую)
    1 мкл РНК (добавьте последнюю)
  6. На короткое время поверните пластину или полоску трубки и снова положите на лед
  7. Немедленно загрузите образцы в Cycler и запустите следующую программу
    MJ Research Cycler Program:
    1.50 ° C 30 минут
    2. 95 ° C 15 минут
    3. 94 ° C 30 секунд
    4. 55 ° C 30 секунд
    5. 72 ° C 30 секунд
    6. ?? ° C 1 10 секунд
    7. На планшете считайте
    8. Перейдите к строке 2 еще 39 раз
    9. Выполните кривую плавления от 65 до 95; читать каждые 0,2 ° C; удерживайте 5 с между чтениями;
    10. Инкубировать при 12 ° C постоянно
    11. Конец

Для устранения неполадок см. Справочник Qiagen QuantiTect SyBr Green RT-PCR, доступный в Интернете.

1 Вставьте соответствующую температуру считывания планшета

Подготовка ДНК для стандартной кривой

Для количественной оценки результатов необходимо построить стандартную кривую. Природа плазмиды, используемой для стандартной кривой, не важна, но температура плавления стандартного ампликона должна быть относительно высокой, чтобы температуру считывания можно было установить оптимально для ампликона, полученного в экспериментальных образцах. Лучше избегать использования плазмиды, которая содержит ген, представляющий интерес для эксперимента, потому что это может вызвать проблемы контаминации.

  1. Разбавьте исходную плазмиду 1: 1000 до разведения 1 нг / мкл.
  2. Приготовить стандарты:
    1 нг — разбавить 1 нг / мкл исходного раствора 1: 8:
    70 мкл исходного раствора ДНК + 490 мкл воды для ПЦР
    0,1 нг — разбавить 1 нг / 8 мкл стандартного раствора 1: 10:
    50 мкл стандарта + 450 мкл воды для ПЦР
    0,01 нг — разбавленный 0,1 нг / 8 мкл стандартного раствора 1:10:
    50 мкл стандарта + 450 мкл воды для ПЦР
    0.001 нг — разбавленный 0,01 нг / 8 мкл стандартного раствора 1:10:
    50 мкл стандарта + 450 мкл воды для ПЦР

Последовательности праймеров для генов внутреннего контроля

Следующие праймеры были успешно разработаны и использованы сотрудниками UDSF для указанных видов. Праймеры были протестированы только на тканях мозга и сердца и могут не подходить для использования на образцах из других тканей / клеточных линий, хотя и из того же вида.

Циклофилин A
Номер доступа
Последовательность праймера (5′-3 ‘) Виды Чтение планшета
T (° C) *
NM_021130 GCGTCTCCTTTGAGCTGTTT (up1)
GTCTTGGCAGTGCAGATGAA (dn2)
Человек ≤ 79
NM_017101 CGAGCTGTTTGCAGACAAAG (вверх)
AGCCACTCAGTCTTGGCAGT (dn)
Крыса ≤ 79
NM_008907 GCATACAGGTCCTGGCATCT (вверх)
TTACAGGACATTGCGAGCAG (dn)
Мышь ≤ 80
AF243140 CGAGCTGTTTGCAGACAAAG (вверх)
CCAAAGACCACATGCTTGCC (dn)
Собака ≤ 81
GAPDH
Номер доступа
Последовательность праймера (5′-3 ‘) Виды Чтение планшета
T (° C) *
NM_017008 TCCTGCACCACCAACTGCTT (вверх)
GTCTTCTGGGTGGCAGTGAT (dn)
Человек ≤ 79
Крыса ≤ 80
Мышь ≤ 80
Собака ≤ 81
Кролик ≤ 82
Морская свинка ≤ 80
Китайский хомяк ≤ 79

* Важно: Значения температуры считывания планшета, приведенные выше, действительны только при использовании наборов Qiagen QuantiTect SyBr Green PCR и RT-PCR.Если вы используете другие коммерческие наборы или наборы ручной работы, проверьте эти температуры экспериментально, прежде чем проводить эксперимент.

1 Праймер «восходящий» или «прямой»
2 «Нисходящий» или «обратный» праймер

Секвенирование продуктов ОТ-ПЦР

  1. Развести данный продукт ПЦР 1: 100 в исходной смеси водой для ПЦР
  2. Используйте разведение праймера 25 мкМ. Эта более высокая концентрация праймера лучше подходит для реакции секвенирования
  3. Объедините реагенты в следующем порядке в 0.Пробирки на 2 мл:
    8 мкл воды для ПЦР
    3 мкл праймера (25 мкМ)
    1 мкл продукта ОТ-ПЦР (разведение 1: 100)

Примечания
Всегда запускайте образцы секвенирования в дубликатах, некоторые последовательности не удастся. Последовательности будут выглядеть зашумленными из-за остаточных праймеров в продукте rtPCR.

Введите названия образцов в компьютер клиента Центра секвенирования ДНК в порядке одной стрип-пробирки за раз.

GENEWIZ | Подготовка образцов — Правила подачи образцов

Для получения наилучших результатов секвенирования по Сэнгеру GENEWIZ настоятельно рекомендует как можно точнее следовать нашим Правилам отправки образцов.Если у вас есть какие-либо вопросы, наша команда технической поддержки всегда готова помочь!

Эл. Почта | Телефон (1-877-GENEWIZ (436-3949), вариант 2) | Живой чат


ДНК Тип Длина ДНК
(включая вектор)
Концентрация матрицы в 10 мкл Общая масса шаблона Ваш праймер Total Picomoles Предварительно смешанный объем *
(шаблон + ваш праймер)
Плазмиды <6 кб ~ 50 нг / мкл ~ 500 нг 25 пмоль 15 мкл
6-10 кб ~ 80 нг / мкл ~ 800 нг
> 10 кб ~ 100 нг / мкл ~ 1000 нг
Очищенные продукты ПЦР <500 п.н. ~ 1 нг / мкл ~ 10 нг 25 пмоль 15 мкл
500 — 1000 п.н. ~ 2 нг / мкл ~ 20 нг
1000-2000 п.н. ~ 4 нг / мкл ~ 40 нг
2000-4000 п.н. ~ 6 нг / мкл ~ 60 нг
> 4000 п.н. Рассматривать как плазмиду Рассматривать как плазмиду

* Если вы используете универсальный праймер GENEWIZ, отправьте необходимое количество шаблона в 10 мкл.

* Для продуктов ПЦР, очищенных с помощью протокола ферментативной очистки (например, ExoSAP-IT), спектрофотометр нельзя использовать для точного количественного определения ДНК. Компоненты реакции, такие как разрушенные праймеры и нуклеотиды, будут поглощать УФ-свет и увеличивать расчетную концентрацию ДНК. Вместо этого используйте интенсивность полосы на агарозном геле по сравнению с массой стандартов для оценки концентрации ДНК. В качестве альтернативы, флуорометр, в котором используется краситель, специфически связывающий дцДНК, может обеспечить точное количественное определение.

ДНК Тип Длина ДНК
(включая вектор)
Концентрация матрицы в 10 мкл Общая масса шаблона Объем шаблона на реакцию Концентрация вашего праймера, мкМ (пмоль / мкл) Ваш объем праймера на реакцию
Плазмиды <6 кб ~ 50 нг / мкл ~ 500 нг 10 мкл 5 мкМ 5 мкл
6-10 кб ~ 80 нг / мкл ~ 800 нг
> 10 кб ~ 100 нг / мкл ~ 1000 нг
Очищенные продукты ПЦР <1000 п.н. ~ 15 нг / мкл ~ 75 нг 5 мкл 5 мкМ 2 мкл
1000-2000 п.н. ~ 25 нг / мкл ~ 125 нг
2000-3000 п.н. ~ 35 нг / мкл ~ 175 нг
> 3000 п.н. Рассматривать как плазмиду Рассматривать как плазмиду

* Для продуктов ПЦР, очищенных с помощью протокола ферментативной очистки (например,грамм. ExoSAP-IT) спектрофотометр нельзя использовать для точного количественного определения ДНК. Компоненты реакции, такие как разрушенные праймеры и нуклеотиды, будут поглощать УФ-свет и увеличивать расчетную концентрацию ДНК. Вместо этого используйте интенсивность полосы на агарозном геле по сравнению с массой стандартов для оценки концентрации ДНК. В качестве альтернативы, флуорометр, в котором используется краситель, специфически связывающий дцДНК, может обеспечить точное количественное определение.

Советы по ПЦР в JAX — Техническая поддержка

Общие советы

  • При сборе кончиков хвостов очищайте инструменты 70% этанола между животными.
  • Используйте наконечники для пипеток с фильтром.
  • Избегайте повторного замораживания и оттаивания нуклеотидов. Разберите небольшие объемы на аликвоты и храните при -70 ° C.
  • НЕ проводите ПЦР в вентилируемом кожухе, так как это увеличивает риск перекрестного заражения.
  • Перемешайте реакционную трубку осторожным постукиванием. Не перемешивайте смесь для ПЦР на вортексе.
  • В последнюю очередь добавляют ДНК-полимеразу (Taq) в реакционную пробирку.
  • Отрегулируйте напряжение электрофореза и время работы для улучшения разрешения полосы.
  • Убедитесь, что аппарат ПЦР был правильно запрограммирован.
  • Избегайте чрезмерного попадания продуктов ПЦР в гель; это может привести к перекрестному заражению или неправильной интерпретации результатов.
Протоколы генотипирования для мышей JAX
® предоставляются в качестве отправной точки для разработки вашего собственного анализа.

Анализ, который хорошо работает в одной лаборатории, может не работать в другой. Условия и компоненты должны быть оптимизированы для условий вашей лаборатории. В некоторых случаях вам может потребоваться обширная оптимизация или разработка нового анализа для получения приемлемых результатов в ваших лабораторных условиях.

Изменить количество ДНК на реакцию.

Слишком много или слишком мало ДНК приведет к плохой амплификации. Запустите серию разведений образцов ДНК, включая неразбавленный образец, и образцы, разбавленные h3O в соотношении 1:10, 1: 100 и 1: 1000. Если вам известна концентрация каждого раствора ДНК, для реакции ПЦР на 25 мкл обычно требуется ~ 5 нг высокоочищенной ДНК или 40-50 нг быстро приготовленной («грязной») ДНК (методы подготовки см. В протоколах выделения ДНК).

Тест «Цикл приземления» в качестве альтернативы мультиплексным реакциям ПЦР.
Цикл приземления

является обычным явлением для многих термоциклеров (инструкции см. В руководстве). Эта функция постепенно изменяет температуру на этапе отжига, чтобы приспособить пары праймеров с разными оптимальными температурами отжига.

Если мультиплексирование реакции неэффективно, разделите пары праймеров.

Если один продукт ПЦР является слабым или отсутствует в мультиплексной реакции, запустите отдельные реакции ПЦР для каждой пары праймеров и оптимизируйте их независимо.

Разведите свежие реагенты для ПЦР и / или выполните новое выделение / разведение ДНК.

Если есть неожиданные изменения в ваших результатах ПЦР (особенно в контроле) или при подозрении на контаминацию, получите свежеприготовленные реагенты.

Используйте другой протокол выделения ДНК.

Для большинства протоколов ПЦР достаточно быстрой «грязной» подготовки ДНК, но некоторые анализы улучшаются при использовании высокоочищенной ДНК. См. Протоколы выделения ДНК.

Грунтовки

Дважды проверьте последовательности праймеров, если контрольные полосы отсутствуют.

Если последовательность верна, рассмотрите возможность заказа новых праймеров, если проблема может быть связана с деградацией или скрытыми производственными ошибками.

Рассмотрите возможность разработки новых праймеров или нового анализа ПЦР.
Протоколы генотипирования

для мышей JAX ® предоставлены в качестве отправной точки для разработки вашего собственного анализа. Ссылки основных исследователей, которые пожертвовали штамм, обычно содержат наиболее обширную генетическую информацию, необходимую для разработки новых праймеров и протоколов. Первичные ссылки можно найти во всех таблицах данных по штамму мышей JAX ® .

Неспецифические полосы

Увеличьте или уменьшите температуру отжига.

Если ожидаемые полосы не усиливаются, снижение температуры отжига может помочь праймерам связываться более эффективно. Если полосы слабые, попробуйте увеличить время продления.

Если полос больше, чем ожидалось (неспецифические полосы амплифицируются), повышение температуры отжига может помочь устранить неспецифическое связывание праймера.

Попробуйте «Горячий старт», чтобы уменьшить количество неспецифических диапазонов.

Предварительно нагрейте термоциклер до 94 ° C перед добавлением образцов, или используйте полимеразу Taq, специфичную для горячего пуска (доступную от большинства компаний, продающих Taq), или используйте антитело к полимеразе Taq в реакционной смеси в соответствии с инструкциями производителя (т.е. TaqStart, BD Biosciences / Clontech, инвентарный номер 639250). Отношение антител TaqStart к ДНК-полимерсе TaqStart 1: 1 обычно используется для процедуры горячего старта.

Используйте Perfect Match® PCR Enhancer для повышения специфичности.

Этот реагент дестабилизирует несовпадающие комплексы праймер-матрица для уменьшения артефактов ПЦР, тем самым способствуя амплификации правильных продуктов ПЦР.

Чтобы уменьшить количество ложноположительных результатов в анализах нео-генотипирования, используйте новые реагенты и чистое оборудование (наконечники для пипеток с фильтром, чистые пипетки, чистое лабораторное место на рабочем столе и т. Д.).
Загрязнение

Neo является обычным явлением и может привести к ложноположительным результатам при генотипировании мышей с использованием neo-специфических праймеров. Вы также можете разработать специфичный для мутаций ПЦР-анализ, в котором используются специфичные для мутации (а не нео-специфичные) праймеры.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *